Isolated methylmalonic acidemia (MMA) is an autosomal recessive disorder that increases methylmalonic acid by affecting the metabolism of propionyl-CoA. Mutations in multiple genes cause MMA, however, those in methylmalonyl-CoA mutase (MMUT) are most common. MMUT is an isomerase that converts methylmalonyl-CoA to succinyl-CoA, a key tricarboxylic acid (TCA) cycle intermediate. The defects in these metabolic processes disproportionately affect hepatocytes in patients with MMA. We performed gene editing in human induced pluripotent stem cells (hiPSCs) to generate loss-of-function mutations within MMUT. Hepatocytes derived from these iPSCs recapitulate key aspects of methylmalonic acidemia, providing a new model of MMA.
","acknowledgements":"The Cell Models and Imaging Cores of the MUSC COBRE in Digestive and Liver Disease and the MUSC Digestive Disease Research Core Center supported the project.
","authors":[{"affiliations":["Medical University of South Carolina, Charleston, SC, US"],"departments":["Regenerative Medicine and Cell Biology"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"pournasr@musc.edu","firstName":"Behshad","lastName":"Pournasr","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Medical University of South Carolina, Charleston, SC, US"],"departments":["Regenerative Medicine and Cell Biology"],"credit":["resources","writing_reviewEditing","conceptualization"],"email":"duncanst@musc.edu","firstName":"Stephen","lastName":"Duncan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2507-7827"}],"awards":[{"awardId":"DK102716","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"DK123704","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Rockey"},{"awardId":"DK119728","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"GM130457","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Duncan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":null,"extendedData":[],"funding":"Work was supported by funds from the National Institutes of Health.
","image":{"url":"https://portal.micropublication.org/uploads/30ab404e534f4d027e0a11fe96ca48ee.jpg"},"imageCaption":"(A) Schematic illustration of MMUT gene structure highlighting exon 3, sequence of CRISPR/Cas9 guide (red arrow), position of the PAM element, and the nucleotide sequences of wild-type (MMUT +/+) and mutant alleles (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (B) Image of a polyacrylamide gel displaying MMUT exon 3 amplicons from wild-type control (MMUT +/+) iPSCs and those harboring mutations (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (C) Fluorescent immunostaining of day 20 hepatocytes derived from wild type (MMUT +/+) and mutant iPSC lines (MMUT Ex3Δ17/+2, MMUT Ex3Δ10/+1, MMUTEx3Δ31/+1) for Albumin (Red), HNF4a (green) and Methylmalonyl-CoA Mutase (MUT, Green), scale bars = 100 µM (Albumin and HNF4a) and 80µM (MUT). (D) Western blot analysis to detect Methylmalonyl-CoA Mutase protein (MUT) in either wild-type (MMUT +/+) or mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSC lines. HSP90 served as a loading control. (E) Bar graphs showing the relative levels of 14C precipitated by TCA from protein extracts from day-20 hepatocytes derived from wild-type (MMUT+/+) and mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSCs (left panel). The mean total protein content of the TCA precipitates did not differ significantly across samples (right panel). Data are represented as mean ± SD, n = 3 - 6 biological replicates.
","imageTitle":"Generation and Characterization of MMUT–deficient iPSCs.
","methods":"MATERIALS AND METHODS
iPSC Lines and Culture
Human K3 iPSCs were previously reprogrammed from human foreskin fibroblasts (Si-Tayeb, Noto, Sepac, et al., 2010). Pluripotent cells were cultured in low oxygen conditions (37°C, 4% O2, 5% CO2) on an E-cadherin-IgG Fc fusion protein matrix (Nagaoka & Duncan, 2012), using defined mTeSR1 culture medium (Ludwig, Levenstein, et al., 2006) supplemented with zebrafish bFGF (40 ng/ml) (Ludwig, Bergendahl, et al., 2006). MMUTEx3Δ17/+2, MMUTEx3Δ10/+1, and MMUTEx3Δ31/+1 cells were generated through CRISPR/Cas9 gene editing (Ran et al., 2013) (Heslop et al., 2021). Pluripotency was assessed by measuring OCT3/4 (Santa Cruz, USA) expression via flow cytometry using a Guava EasyCyte mini and differentiation to hepatocytes.
CRISPR-mediated gene targeting
CRISPR guide RNAs (gRNAs) targeting exon 3 of the MMUT gene were designed using an algorithm developed by Ran et al. Guide RNA sequences (Forward: CACCGTTTGATCTGGCGACACATCG; AAACCGATGTGTCGCCAGATCAAAC) were cloned into the PX459 pSPCas9(BB)-2A-Puro vector version 2 (Ran et al., 2013). K3 (MMUT+/+) iPSCs were seeded on to a Geltrex-coated (ThermoFisher/Gibco, CA, #A1413302) 10cm2 tissue culture plate at 70-75% confluency. The following day, 60μg of the CRISPR/Cas9 plasmid containing gRNA was introduced into the pluripotent cells by electroporation. After 24 hours, 1 μg/ml of puromycin (Sigma Aldrich, MO, #P9620) was added to the culture medium for 48 hours to select for transfected cells. The surviving cell colonies were expanded, and samples from each were collected after 7-10 days for genomic DNA analyses. Indels were amplified using Herculase Fusion Polymerase (Agilent, CA, #600675), with the primer set (TGGTCAGCAGGGATTATCAG, CAGTGTCAATAGCATCTCCAGC). Amplicons were resolved by polyacrylamide gel electrophoresis using 4%–20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225). Potential INDELs were confirmed by DNA sequencing of amplicons and analyzed using TIDE (Brinkman & van Steensel, 2019).
Differentiation of pluripotent stem cells
iPSCs were differentiated following a previously published protocol (Mallanna & Duncan, 2013). Briefly, cells were plated at 80% confluency on Matrigel-coated tissue culture plates. The next day, the media was replaced with RPMI medium containing B27 minus insulin (ThermoFisher Scientific, NY, #A1895601), Activin A (100 ng/ml; ThermoFisher Scientific, NY, #PHC9563), fibroblast growth factor 2 (FGF2, 20 ng/ml; ThermoFisher Scientific, NY, #PHG0023), and bone morphogenetic protein 4 (BMP4, 10 ng/ml; ThermoFisher Scientific, NY, #PHC9533) for 48 hours with daily media changes. To commit the populations to a definitive endoderm fate, cells were cultured in RPMI medium supplemented with B27 minus insulin and Activin A (100 ng/ml) for 48 hours, with daily media changes. Over the next five days, the cells were treated with B27 Supplement, 10 ng/mL FGF2, and 20 ng/mL BMP4 to convert them from definitive endoderm to hepatic progenitor cells. The cells were then cultured for an additional five days in B27 Supplement and 20 ng/mL Hepatocyte Growth Factor (Invitrogen, MA, #PHG0321) to generate immature hepatocytes. Finally, during the last five days of differentiation, they were induced to mature hepatocyte-like cells by culturing in HCM medium (Lonza, MD, #CC3198) supplemented with 20 ng/mL Oncostatin M (Invitrogen, MA, #PHC5015).
14C propionate fixation assay
The differentiated cells were treated with 14C-propionate at a final concentration of 1 µCi/ml in hepatocyte medium overnight. The next day, both treated and untreated cells were enzymatically harvested with 0.25% trypsin-EDTA for 10 minutes at 37 °C after at two washes with PBS. The final pellet was resuspended in 5% TCA and incubated on ice for 30 minutes. The supernatant was removed by centrifugation, and 1N NaOH was added to make the samples soluble and ready for measurement of 14C incorporation using a Beckman Coulter 156500 scintillation counter (Willard et al., 1976).
Immunofluorescence
Cells were differentiated, washed once with PBS, and fixed with 4% paraformaldehyde (w/v; Santa Cruz, TX, #sc-281692) for 20 minutes. After washing the samples three times with PBS, they were permeabilized using 0.4% Triton X-100 for 20 minutes. Then, 3% BSA (w/v) in PBS was added for 1 hour to block the samples. The blocking solution was removed, and primary antibodies were applied and incubated overnight at 4°C in 1% BSA (w/v). The antibodies used included HNF4A (Santa Cruz, #sc-6556, 1:100) and Albumin (Cedarlane, #CL2513A, 1:500). The next day, the cells were washed three times with 1% BSA (w/v) in PBS and stained with DAPI (1 μg/ml; Sigma Aldrich, MO, #D1388) and AlexaFluor488 or AlexaFluor594 conjugated secondary antibodies (1:1000; ThermoFisher Scientific, NY) for 2 hours at room temperature. After three PBS washes, imaging was performed using a ZOE fluorescent cell imager (BioRad, CA). All images were processed identically.
Immunoblotting
Cell lysates were collected using 1x RIPA buffer (Millipore, MA, #20-188) containing HALT protease inhibitor cocktail (ThermoFisher Scientific, NY, #78443) after washing the cells with PBS. Protein content was determined by a BCA assay (ThermoFisher/Pierce, IL, #23227). 10-30 μg of total protein was separated by SDS–PAGE in 4%–15% Mini-Protean TGX stain-free precast gels (BioRad, CA, #4568184). Separated proteins were transferred to PVDF membranes using the Trans-Blot Turbo Transfer System (BioRad, CA, #1704155). Membranes were blocked with 5% BSA (w/v) in TBS with 0.1% Tween (TBS-T) for one hour at room temperature. They were incubated overnight in 1% BSA in TBS-T at 4°C with antibodies against MUT (Santa Cruz, #sc-390978, 1:200) and HSP90b (Abcam, #ab32568, 1:100000). The next day, membranes were washed with 1% BSA (w/v) in TBS-T and then incubated with HRP-conjugated secondary antibodies for 2 hours at room temperature, followed by three washes with TBS-T. Clarity chemiluminescent reagent (BioRad, CA, #1705061) was applied for 1-5 minutes. Blot images were captured using the Chemidoc Touch gel imager (BioRad, CA).
Quantitative Real-Time PCR Analysis
RNA was isolated using the RNeasy Mini Kit following the manufacturer’s instructions (QIAGEN, #74106). RNA was treated with TURBO DNase (ThermoFisher/Ambion, NY, #AM1907) on column during RNA extraction. M-MLV Reverse Transcriptase (ThermoFisher/Invitrogen, NY, #28025-013) was used to generate cDNA. Quantitative real-time PCR (qRT-PCR) analysis was performed on a CFX384 real-time PCR machine (BioRad, CA) using TaqMan® Gene Expression assays (ThermoFisher/Applied Biosystems, NY, #4369016). Primer sets were purchased from Integrated DNA Technologies (Integrated DNA Technologies, IA).
Quantification and statistical analysis
Graphs were created using Excel or GraphPad Prism. Statistical analyses were performed with Prism 8. For the analysis, experiments were repeated at least three times, and the statistical significance of percentage differences between iPSC lines was assessed using ANOVA followed by Tukey’s post hoc test.
","reagents":"","patternDescription":"DESCRIPTION
Methylmalonic acidemia (MMA) is an autosomal recessive disorder of the metabolism of branched-chain amino acids. It has been estimated that between 60-70% of MMA cases are caused by mutations in the MMUT gene that encodes the mitochondrial enzyme methylmalonyl-CoA mutase. (Habibzadeh et al., 2020). This enzyme catalyzes the conversion of methylmalonyl-CoA to succinyl-CoA (Fraser & Venditti, 2016). Affected patients fail to thrive and suffer from various clinical complications, including metabolic stroke, end-stage liver and renal failure, seizures, and developmental delays (Caterino et al., 2016) (Keyfi et al., 2016). Current treatments focus on limiting exposure to branched-chain amino acids through low-protein diets; however, these treatments fail to prevent substantial morbidity and mortality (Fraser & Venditti, 2016). Recent advances in mRNA (An et al., 2017) and gene therapy in animal models show some promise (Chandler & Venditti, 2019) (Senac et al., 2012); Unfortunately, for severely affected patients, liver transplants are the only beneficial option (Sen et al., 2023). The limitations of available therapeutics reflect a lack of models suitable for studying the molecular mechanisms of MMA and for identifying therapeutics (Hansen & Horslen, 2008). Although some mouse models of MMA can survive long-term (Chandler et al., 2022), differences between mice and humans limit their value. Human pluripotent stem cells that can be induced to differentiate into hepatocytes (Si-Tayeb, Noto, Nagaoka, et al., 2010) (Mallanna & Duncan, 2013) offer considerable potential as an alternative to rodents for modeling rare inborn errors in human metabolism (Musunuru, 2013) and as a platform for drug discovery.
We used CRISPR/Cas9 genome editing (Figure 1A) to generate a series of isogenic iPSCs harboring an MMUT gene mutation. A CRISPR guide RNA was designed to target exon 3 of MMUT, ensuring that any resulting frameshift mutations would inactivate enzyme activity, which is encoded by exons 8-12. Clonal cell lines were established and confirmed to express pluripotency markers via flow cytometry. PCR analyses (Figure 1B) and DNA sequencing (Figure 1A) were used to identify mutations. Three independent compound heterozygous lines were retained: MMUTEx3∆17/+2, has a 17-base pair deletion in one allele and a 2-base pair insertion in the other; MMUTEx3Δ10/+1, has a 10-base pair deletion and a 1-base pair insertion; and MMUTEx3Δ31/+1, has a 31-base pair deletion and a 1-base pair insertion. All alleles were predicted to cause frameshifts leading to premature stop codons downstream of Exon 3: MMUTEx3∆17/+2 (p.Phe138SerfsTer141; Arg144PhefsTer180), MMUTEx3Δ10/+1 (p.Ala141ValfsTer176; His143GlnfsTer147), and MMUTEx3Δ31/+1 (p.Ala137ValfsTer167; Arg144SerfsTer147).
We compared the ability of MMUT-deficient and control MMUT+/+ iPSCs to differentiate into hepatocyte-like cells using our standard protocol, as previously described in detail (Si-Tayeb, Noto, Nagaoka, et al., 2010). After 20 days of differentiation, immunostaining showed that all cells strongly expressed characteristic hepatocyte markers, including Albumin and the transcription factor HNF4a (Figure 1C). Moreover, an anti-methylmalonase mutase antibody stained MUT+/+ iPSC-derived hepatocytes, but no signal was detected in any of the mutant cells. We finally evaluated the effect of the mutations on MUT protein expression using immunoblot analysis. Figure 1D shows that the MUT protein was highly expressed in control cells but was undetectable in all three MMUT-disrupted lines (Figure 1D), consistent with predictions from DNA sequence analysis and the immunostaining experiments.
We next performed a 14C-propionate fixation assay to determine whether mutations in MMUT restricted propionate metabolism. The 14C-propionate fixation assay is a sensitive, reliable, and straightforward method for detecting inborn errors of propionate, methylmalonate, and cobalamin metabolism. This test is often employed to confirm MMA clinically, especially when genetic evidence is lacking (Forny et al., 2021). It works by providing 14C-propionate to cells that rely on methylmalonyl-CoA mutase to facilitate the incorporation (fixation) of 14C into acid-precipitable materials, including organic acids, amino acids, and proteins through the TCA cycle. Figure 1E shows that, although total protein levels were similar across all cells, 14C fixation was markedly and significantly reduced in all three methylmalonyl-CoA mutase-deficient cells compared to the parental control MMUT+/+ cells.
In summary, MMA is a serious disease caused by defects in the liver's ability to process branched-chain amino acids. Our data describe the creation of human iPSCs with mutations in the MMUT gene, which is the most common cause of MMA. We suggest that such cells could serve as a platform to better understand the role of hepatocytes in MMA and to help discover new treatments.
","references":[{"reference":"An D, Schneller JL, Frassetto A, Liang S, Zhu X, Park JS, et al., Martini. 2017. Systemic Messenger RNA Therapy as a Treatment for Methylmalonic Acidemia. Cell Reports 21: 3548-3558.
","pubmedId":"","doi":"10.1016/j.celrep.2017.11.081 "},{"reference":"Brinkman EK, van Steensel B. 2019. Rapid Quantitative Evaluation of CRISPR Genome Editing by TIDE and TIDER. Methods in Molecular Biology,CRISPR Gene Editing : 29-44.
","pubmedId":"","doi":"10.1007/978-1-4939-9170-9_3 "},{"reference":"Caterino M, Chandler RJ, Sloan JL, Dorko K, Cusmano-Ozog K, Ingenito L, et al., Ruoppolo. 2015. The proteome of methylmalonic acidemia (MMA): the elucidation of altered pathways in patient livers. Molecular BioSystems 12: 566-574.
","pubmedId":"","doi":"10.1039/c5mb00736d "},{"reference":"Chandler RJ, Di Pasquale G, Sloan JL, McCoy S, Hubbard BT, Kilts TM, et al., Venditti. 2022. Systemic gene therapy for methylmalonic acidemia using the novel adeno-associated viral vector 44.9. Molecular Therapy - Methods & Clinical Development 27: 61-72.
","pubmedId":"","doi":"10.1016/j.omtm.2022.09.001 "},{"reference":"Chandler RJ, Venditti CP. 2019. Gene Therapy for Methylmalonic Acidemia: Past, Present, and Future. Human Gene Therapy 30: 1236-1244.
","pubmedId":"","doi":"10.1089/hum.2019.113 "},{"reference":"Forny P, Hörster F, Ballhausen D, Chakrapani A, Chapman KA, Dionisi‐Vici C, et al., Baumgartner. 2021. Guidelines for the diagnosis and management of methylmalonic acidaemia and propionic acidaemia: First revision. Journal of Inherited Metabolic Disease 44: 566-592.
","pubmedId":"","doi":"10.1002/jimd.12370 "},{"reference":"Fraser JL, Venditti CP. 2016. Methylmalonic and propionic acidemias: clinical management update. Current Opinion in Pediatrics 28: 682-693.
","pubmedId":"","doi":"10.1097/MOP.0000000000000422 "},{"reference":"Habibzadeh P, Tabatabaei Z, Farazi Fard MA, Jamali L, Hafizi A, Nikuei P, et al., Faghihi. 2020. Pre-implantation genetic diagnosis in an Iranian family with a novel mutation in MUT gene. BMC Medical Genetics 21: 10.1186/s12881-020-0959-8.
","pubmedId":"","doi":"10.1186/s12881-020-0959-8 "},{"reference":"Hansen K, Horslen S. 2008. Metabolic liver disease in children. Liver Transplantation 14: 713-733.
","pubmedId":"","doi":"10.1002/lt.21520 "},{"reference":"Heslop JA, Pournasr B, Liu JT, Duncan SA. 2021. GATA6 defines endoderm fate by controlling chromatin accessibility during differentiation of human-induced pluripotent stem cells. Cell Reports 35: 109145.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109145 "},{"reference":"Keyfi F, Talebi S, Varasteh AR. 2016. Methylmalonic Acidemia Diagnosis by Laboratory Methods. Rep Biochem Mol Biol 5(1): 1-14.
","pubmedId":"28070528","doi":""},{"reference":"Ludwig TE, Bergendahl V, Levenstein ME, Yu J, Probasco MD, Thomson JA. 2006. Feeder-independent culture of human embryonic stem cells. Nature Methods 3: 637-646.
","pubmedId":"","doi":"10.1038/nmeth902 "},{"reference":"Ludwig TE, Levenstein ME, Jones JM, Berggren WT, Mitchen ER, Frane JL, et al., Thomson. 2006. Derivation of human embryonic stem cells in defined conditions. Nature Biotechnology 24: 185-187.
","pubmedId":"","doi":"10.1038/nbt1177 "},{"reference":"Mallanna SK, Duncan SA. 2013. Differentiation of Hepatocytes from Pluripotent Stem Cells. Current Protocols in Stem Cell Biology 26: 10.1002/9780470151808.sc01g04s26.
","pubmedId":"","doi":"10.1002/9780470151808.sc01g04s26 "},{"reference":"Musunuru K. 2013. Genome editing of human pluripotent stem cells to generate human cellular disease models. Disease Models & Mechanisms : 10.1242/dmm.012054.
","pubmedId":"","doi":"10.1242/dmm.012054 "},{"reference":"Nagaoka M, Si-Tayeb K, Akaike T, Duncan SA. 2010. Culture of human pluripotent stem cells using completely defined conditions on a recombinant E-cadherin substratum. BMC Developmental Biology 10: 10.1186/1471-213x-10-60.
","pubmedId":"","doi":"10.1186/1471-213X-10-60 "},{"reference":"Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8: 2281-2308.
","pubmedId":"","doi":"10.1038/nprot.2013.143 "},{"reference":"Sen K, Burrage LC, Chapman KA, Ginevic I, Mazariegos GV, Graham BH. 2023. Solid organ transplantation in methylmalonic acidemia and propionic acidemia: A points to consider statement of the American College of Medical Genetics and Genomics (ACMG). Genetics in Medicine 25: 100337.
","pubmedId":"","doi":"10.1016/j.gim.2022.11.005 "},{"reference":"Sénac JS, Chandler RJ, Sysol JR, Li L, Venditti CP. 2011. Gene therapy in a murine model of methylmalonic acidemia using rAAV9-mediated gene delivery. Gene Therapy 19: 385-391.
","pubmedId":"","doi":"10.1038/gt.2011.108 "},{"reference":"Si-Tayeb K, Noto FK, Nagaoka M, Li J, Battle MA, Duris C, et al., Duncan. 2010. Highly Efficient Generation of Human Hepatocyte–Like Cells From Induced Pluripotent Stem Cells. Hepatology 51: 297-305.
","pubmedId":"","doi":"10.1002/hep.23354 "},{"reference":"Si-Tayeb K, Noto FK, Sepac A, Sedlic F, Bosnjak ZJ, Lough JW, Duncan SA. 2010. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding reprogramming factors. BMC Developmental Biology 10: 10.1186/1471-213x-10-81.
","pubmedId":"","doi":"10.1186/1471-213X-10-81 "},{"reference":"Willard HF, Ambani LM, Hart AC, Mahoney MJ, Rosenberg LE. 1976. Rapid prenatal and postnatal detection of inborn errors of propionate, methylmalonate, and cobalamin metabolism: A sensitive assay using cultured cells. Human Genetics 34: 277-283.
","pubmedId":"","doi":"10.1007/BF00295291 "}],"title":"Modeling Inherited Methylmalonic Acidemia Using Isogenic Human Induced Pluripotent Stem Cell-Derived Hepatocytes with Mutations in Methylmalonyl-CoA Mutase
","reviews":[{"reviewer":{"displayName":"Ravi Misra"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[]},{"id":"80854448-89dc-45c1-8d2d-bfe3568b7ba2","decision":"accept","abstract":"Isolated methylmalonic acidemia (MMA) is an autosomal recessive disorder that increases methylmalonic acid by affecting the metabolism of propionyl-CoA. Mutations in multiple genes cause MMA, however, those in methylmalonyl-CoA mutase (MMUT) are most common. MMUT is an isomerase that converts methylmalonyl-CoA to succinyl-CoA, a key tricarboxylic acid (TCA) cycle intermediate. The defects in these metabolic processes disproportionately affect hepatocytes in patients with MMA. We performed gene editing in human induced pluripotent stem cells (hiPSCs) to generate loss-of-function mutations within MMUT. Hepatocytes derived from these iPSCs recapitulate key aspects of methylmalonic acidemia, providing a new model of MMA.
","acknowledgements":"The Cell Models and Imaging Cores of the MUSC COBRE in Digestive and Liver Disease and the MUSC Digestive Disease Research Core Center supported the project.
","authors":[{"affiliations":["Medical University of South Carolina, Charleston, SC, United States","Citadel, Charleston, SC, United States"],"departments":["Regenerative Medicine and Cell Biology","Department of Biology,"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"pournasr@musc.edu","firstName":"Behshad","lastName":"Pournasr","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Medical University of South Carolina, Charleston, SC, US"],"departments":["Regenerative Medicine and Cell Biology"],"credit":["resources","writing_reviewEditing","conceptualization"],"email":"duncanst@musc.edu","firstName":"Stephen","lastName":"Duncan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2507-7827"}],"awards":[{"awardId":"DK102716","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"DK123704","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Rockey"},{"awardId":"DK119728","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"GM130457","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Duncan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Work was supported by funds from the National Institutes of Health.
","image":{"url":"https://portal.micropublication.org/uploads/30ab404e534f4d027e0a11fe96ca48ee.jpg"},"imageCaption":"(A) Schematic illustration of MMUT gene structure highlighting exon 3, sequence of CRISPR/Cas9 guide (red arrow), position of the PAM element, and the nucleotide sequences of wild-type (MMUT +/+) and mutant alleles (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (B) Image of a polyacrylamide gel displaying MMUT exon 3 amplicons from wild-type control (MMUT +/+) iPSCs and those harboring mutations (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (C) Fluorescent immunostaining of day 20 hepatocytes derived from wild type (MMUT +/+) and mutant iPSC lines (MMUT Ex3Δ17/+2, MMUT Ex3Δ10/+1, MMUTEx3Δ31/+1) for Albumin (Red), HNF4a (green) and Methylmalonyl-CoA Mutase (MUT, Green), scale bars = 100 µM (Albumin and HNF4a) and 80µM (MUT). (D) Western blot analysis to detect Methylmalonyl-CoA Mutase protein (MUT) in either wild-type (MMUT +/+) or mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSC lines. HSP90 served as a loading control. (E) Bar graphs showing the relative levels of 14C precipitated by TCA from protein extracts from day-20 hepatocytes derived from wild-type (MMUT+/+) and mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSCs (left panel). The mean total protein content of the TCA precipitates did not differ significantly across samples (right panel). Data are represented as mean ± SD, n = 3 - 6 biological replicates.
","imageTitle":"Generation and Characterization of MMUT–deficient iPSCs
","methods":"MATERIALS AND METHODS
iPSC Lines and Culture
Human K3 iPSCs were previously reprogrammed from human foreskin fibroblasts (Si-Tayeb, Noto, Sepac, et al., 2010). Pluripotent cells were cultured in low oxygen conditions (37°C, 4% O2, 5% CO2) on an E-cadherin-IgG Fc fusion protein matrix (Nagaoka & Duncan, 2012), using defined mTeSR1 culture medium (Ludwig, Levenstein, et al., 2006) supplemented with zebrafish bFGF (40 ng/ml) (Ludwig, Bergendahl, et al., 2006). MMUTEx3Δ17/+2, MMUTEx3Δ10/+1, and MMUTEx3Δ31/+1 cells were generated through CRISPR/Cas9 gene editing (Ran et al., 2013) (Heslop et al., 2021). Pluripotency was assessed by measuring OCT3/4 (Santa Cruz, USA) expression via flow cytometry using a Guava EasyCyte mini and differentiation to hepatocytes.
CRISPR-mediated gene targeting
CRISPR guide RNAs (gRNAs) targeting exon 3 of the MMUT gene were designed using an algorithm developed by Ran et al. Guide RNA sequences (Forward: CACCGTTTGATCTGGCGACACATCG; AAACCGATGTGTCGCCAGATCAAAC) were cloned into the PX459 pSPCas9(BB)-2A-Puro vector version 2 (Ran et al., 2013). K3 (MMUT+/+) iPSCs were seeded on to a Geltrex-coated (ThermoFisher/Gibco, CA, #A1413302) 10cm2 tissue culture plate at 70-75% confluency. The following day, 60μg of the CRISPR/Cas9 plasmid containing gRNA was introduced into the pluripotent cells by electroporation. After 24 hours, 1 μg/ml of puromycin (Sigma Aldrich, MO, #P9620) was added to the culture medium for 48 hours to select for transfected cells. The surviving cell colonies were expanded, and samples from each were collected after 7-10 days for genomic DNA analyses. Indels were amplified using Herculase Fusion Polymerase (Agilent, CA, #600675), with the primer set (TGGTCAGCAGGGATTATCAG, CAGTGTCAATAGCATCTCCAGC). Amplicons were resolved by polyacrylamide gel electrophoresis using 4%–20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225). Potential INDELs were confirmed by DNA sequencing of amplicons and analyzed using TIDE (Brinkman & van Steensel, 2019).
Differentiation of pluripotent stem cells
iPSCs were differentiated following a previously published protocol (Mallanna & Duncan, 2013). Briefly, cells were plated at 80% confluency on Matrigel-coated tissue culture plates. The next day, the media was replaced with RPMI medium containing B27 minus insulin (ThermoFisher Scientific, NY, #A1895601), Activin A (100 ng/ml; ThermoFisher Scientific, NY, #PHC9563), fibroblast growth factor 2 (FGF2, 20 ng/ml; ThermoFisher Scientific, NY, #PHG0023), and bone morphogenetic protein 4 (BMP4, 10 ng/ml; ThermoFisher Scientific, NY, #PHC9533) for 48 hours with daily media changes. To commit the populations to a definitive endoderm fate, cells were cultured in RPMI medium supplemented with B27 minus insulin and Activin A (100 ng/ml) for 48 hours, with daily media changes. Over the next five days, the cells were treated with B27 Supplement, 10 ng/mL FGF2, and 20 ng/mL BMP4 to convert them from definitive endoderm to hepatic progenitor cells. The cells were then cultured for an additional five days in B27 Supplement and 20 ng/mL Hepatocyte Growth Factor (Invitrogen, MA, #PHG0321) to generate immature hepatocytes. Finally, during the last five days of differentiation, they were induced to mature hepatocyte-like cells by culturing in HCM medium (Lonza, MD, #CC3198) supplemented with 20 ng/mL Oncostatin M (Invitrogen, MA, #PHC5015).
14C propionate fixation assay
The differentiated cells were treated with 14C-propionate at a final concentration of 1 µCi/ml in hepatocyte medium overnight. The next day, both treated and untreated cells were enzymatically harvested with 0.25% trypsin-EDTA for 10 minutes at 37 °C after at two washes with PBS. The final pellet was resuspended in 5% TCA and incubated on ice for 30 minutes. The supernatant was removed by centrifugation, and 1N NaOH was added to make the samples soluble and ready for measurement of 14C incorporation using a Beckman Coulter 156500 scintillation counter (Willard et al., 1976).
Immunofluorescence
Cells were differentiated, washed once with PBS, and fixed with 4% paraformaldehyde (w/v; Santa Cruz, TX, #sc-281692) for 20 minutes. After washing the samples three times with PBS, they were permeabilized using 0.4% Triton X-100 for 20 minutes. Then, 3% BSA (w/v) in PBS was added for 1 hour to block the samples. The blocking solution was removed, and primary antibodies were applied and incubated overnight at 4°C in 1% BSA (w/v). The antibodies used included HNF4A (Santa Cruz, #sc-6556, 1:100) and Albumin (Cedarlane, #CL2513A, 1:500). The next day, the cells were washed three times with 1% BSA (w/v) in PBS and stained with DAPI (1 μg/ml; Sigma Aldrich, MO, #D1388) and AlexaFluor488 or AlexaFluor594 conjugated secondary antibodies (1:1000; ThermoFisher Scientific, NY) for 2 hours at room temperature. After three PBS washes, imaging was performed using a ZOE fluorescent cell imager (BioRad, CA). All images were processed identically.
Immunoblotting
Cell lysates were collected using 1x RIPA buffer (Millipore, MA, #20-188) containing HALT protease inhibitor cocktail (ThermoFisher Scientific, NY, #78443) after washing the cells with PBS. Protein content was determined by a BCA assay (ThermoFisher/Pierce, IL, #23227). 10-30 μg of total protein was separated by SDS–PAGE in 4%–15% Mini-Protean TGX stain-free precast gels (BioRad, CA, #4568184). Separated proteins were transferred to PVDF membranes using the Trans-Blot Turbo Transfer System (BioRad, CA, #1704155). Membranes were blocked with 5% BSA (w/v) in TBS with 0.1% Tween (TBS-T) for one hour at room temperature. They were incubated overnight in 1% BSA in TBS-T at 4°C with antibodies against MUT (Santa Cruz, #sc-390978, 1:200) and HSP90b (Abcam, #ab32568, 1:100000). The next day, membranes were washed with 1% BSA (w/v) in TBS-T and then incubated with HRP-conjugated secondary antibodies for 2 hours at room temperature, followed by three washes with TBS-T. Clarity chemiluminescent reagent (BioRad, CA, #1705061) was applied for 1-5 minutes. Blot images were captured using the Chemidoc Touch gel imager (BioRad, CA).
Quantitative Real-Time PCR Analysis
RNA was isolated using the RNeasy Mini Kit following the manufacturer’s instructions (QIAGEN, #74106). RNA was treated with TURBO DNase (ThermoFisher/Ambion, NY, #AM1907) on column during RNA extraction. M-MLV Reverse Transcriptase (ThermoFisher/Invitrogen, NY, #28025-013) was used to generate cDNA. Quantitative real-time PCR (qRT-PCR) analysis was performed on a CFX384 real-time PCR machine (BioRad, CA) using TaqMan® Gene Expression assays (ThermoFisher/Applied Biosystems, NY, #4369016). Primer sets were purchased from Integrated DNA Technologies (Integrated DNA Technologies, IA).
Quantification and statistical analysis
Graphs were generated using Microsoft Excel or GraphPad Prism. Statistical analyses were performed using GraphPad Prism 8. For all analyses, experiments were performed in at least three independent biological replicates (n = independent biological replicates). Statistical significance between iPSC-derived cell lines was assessed using one-way ANOVA followed by Tukey’s post hoc multiple comparisons test.
","reagents":"","patternDescription":"DESCRIPTION
Methylmalonic acidemia (MMA) is an autosomal recessive disorder of the metabolism of branched-chain amino acids. It has been estimated that between 60-70% of MMA cases are caused by mutations in the MMUT gene that encodes the mitochondrial enzyme methylmalonyl-CoA mutase. (Habibzadeh et al., 2020). This enzyme catalyzes the conversion of methylmalonyl-CoA to succinyl-CoA (Fraser & Venditti, 2016). Affected patients fail to thrive and suffer from various clinical complications, including metabolic stroke, end-stage liver and renal failure, seizures, and developmental delays (Caterino et al., 2016) (Keyfi et al., 2016). Current treatments focus on limiting exposure to branched-chain amino acids through low-protein diets; however, these treatments fail to prevent substantial morbidity and mortality (Fraser & Venditti, 2016). Recent advances in mRNA (An et al., 2017) and gene therapy in animal models show some promise (Chandler & Venditti, 2019) (Senac et al., 2012); Unfortunately, for severely affected patients, liver transplants are the only beneficial option (Sen et al., 2023). The limitations of available therapeutics reflect a lack of models suitable for studying the molecular mechanisms of MMA and for identifying therapeutics (Hansen & Horslen, 2008). Although some mouse models of MMA can survive long-term (Chandler et al., 2022), differences between mice and humans limit their value. Human pluripotent stem cells that can be induced to differentiate into hepatocytes (Si-Tayeb, Noto, Nagaoka, et al., 2010) (Mallanna & Duncan, 2013) offer considerable potential as an alternative to rodents for modeling rare inborn errors in human metabolism (Musunuru, 2013) and as a platform for drug discovery.
We used CRISPR/Cas9 genome editing (Figure 1A) to generate a series of isogenic iPSCs harboring an MMUT gene mutation. A CRISPR guide RNA was designed to target exon 3 of MMUT, ensuring that any resulting frameshift mutations would inactivate enzyme activity, which is encoded by exons 8-12. Clonal cell lines were established and confirmed to express pluripotency markers via flow cytometry. PCR analyses (Figure 1B) and DNA sequencing (Figure 1A) were used to identify mutations. Three independent compound heterozygous lines were retained: MMUTEx3∆17/+2, has a 17-base pair deletion in one allele and a 2-base pair insertion in the other; MMUTEx3Δ10/+1, has a 10-base pair deletion and a 1-base pair insertion; and MMUTEx3Δ31/+1, has a 31-base pair deletion and a 1-base pair insertion. All alleles were predicted to cause frameshifts leading to premature stop codons downstream of Exon 3: MMUTEx3∆17/+2 (p.Phe138SerfsTer141; Arg144PhefsTer180), MMUTEx3Δ10/+1 (p.Ala141ValfsTer176; His143GlnfsTer147), and MMUTEx3Δ31/+1 (p.Ala137ValfsTer167; Arg144SerfsTer147).
We compared the ability of MMUT-deficient and control MMUT+/+ iPSCs to differentiate into hepatocyte-like cells using our standard protocol, as previously described in detail (Si-Tayeb, Noto, Nagaoka, et al., 2010). After 20 days of differentiation, immunostaining showed that all cells strongly expressed characteristic hepatocyte markers, including Albumin and the transcription factor HNF4a (Figure 1C). Moreover, an anti-methylmalonase mutase antibody stained MUT+/+ iPSC-derived hepatocytes, but no signal was detected in any of the mutant cells. We finally evaluated the effect of the mutations on MUT protein expression using immunoblot analysis. Figure 1D shows that the MUT protein was highly expressed in control cells but was undetectable in all three MMUT-disrupted lines (Figure 1D), consistent with predictions from DNA sequence analysis and the immunostaining experiments.
We next performed a 14C-propionate fixation assay to determine whether mutations in MMUT restricted propionate metabolism. The 14C-propionate fixation assay is a sensitive, reliable, and straightforward method for detecting inborn errors of propionate, methylmalonate, and cobalamin metabolism. This test is often employed to confirm MMA clinically, especially when genetic evidence is lacking (Forny et al., 2021). It works by providing 14C-propionate to cells that rely on methylmalonyl-CoA mutase to facilitate the incorporation (fixation) of 14C into acid-precipitable materials, including organic acids, amino acids, and proteins through the TCA cycle. Figure 1E shows that, although total protein levels were similar across all cells, 14C fixation was markedly and significantly reduced in all three methylmalonyl-CoA mutase-deficient cells compared to the parental control MMUT+/+ cells.
In summary, MMA is a serious disease caused by defects in the liver's ability to process branched-chain amino acids. Our data describe the creation of human iPSCs with mutations in the MMUT gene, which is the most common cause of MMA. We suggest that such cells could serve as a platform to better understand the role of hepatocytes in MMA and to help discover new treatments.
","references":[{"reference":"An D, Schneller JL, Frassetto A, Liang S, Zhu X, Park JS, et al., Martini. 2017. Systemic Messenger RNA Therapy as a Treatment for Methylmalonic Acidemia. Cell Reports 21: 3548-3558.
","pubmedId":"","doi":"10.1016/j.celrep.2017.11.081 "},{"reference":"Brinkman EK, van Steensel B. 2019. Rapid Quantitative Evaluation of CRISPR Genome Editing by TIDE and TIDER. Methods in Molecular Biology,CRISPR Gene Editing : 29-44.
","pubmedId":"","doi":"10.1007/978-1-4939-9170-9_3 "},{"reference":"Caterino M, Chandler RJ, Sloan JL, Dorko K, Cusmano-Ozog K, Ingenito L, et al., Ruoppolo. 2015. The proteome of methylmalonic acidemia (MMA): the elucidation of altered pathways in patient livers. Molecular BioSystems 12: 566-574.
","pubmedId":"","doi":"10.1039/c5mb00736d "},{"reference":"Chandler RJ, Di Pasquale G, Sloan JL, McCoy S, Hubbard BT, Kilts TM, et al., Venditti. 2022. Systemic gene therapy for methylmalonic acidemia using the novel adeno-associated viral vector 44.9. Molecular Therapy - Methods & Clinical Development 27: 61-72.
","pubmedId":"","doi":"10.1016/j.omtm.2022.09.001 "},{"reference":"Chandler RJ, Venditti CP. 2019. Gene Therapy for Methylmalonic Acidemia: Past, Present, and Future. Human Gene Therapy 30: 1236-1244.
","pubmedId":"","doi":"10.1089/hum.2019.113 "},{"reference":"Forny P, Hörster F, Ballhausen D, Chakrapani A, Chapman KA, Dionisi‐Vici C, et al., Baumgartner. 2021. Guidelines for the diagnosis and management of methylmalonic acidaemia and propionic acidaemia: First revision. Journal of Inherited Metabolic Disease 44: 566-592.
","pubmedId":"","doi":"10.1002/jimd.12370 "},{"reference":"Fraser JL, Venditti CP. 2016. Methylmalonic and propionic acidemias: clinical management update. Current Opinion in Pediatrics 28: 682-693.
","pubmedId":"","doi":"10.1097/MOP.0000000000000422 "},{"reference":"Habibzadeh P, Tabatabaei Z, Farazi Fard MA, Jamali L, Hafizi A, Nikuei P, et al., Faghihi. 2020. Pre-implantation genetic diagnosis in an Iranian family with a novel mutation in MUT gene. BMC Medical Genetics 21: 10.1186/s12881-020-0959-8.
","pubmedId":"","doi":"10.1186/s12881-020-0959-8 "},{"reference":"Hansen K, Horslen S. 2008. Metabolic liver disease in children. Liver Transplantation 14: 713-733.
","pubmedId":"","doi":"10.1002/lt.21520 "},{"reference":"Heslop JA, Pournasr B, Liu JT, Duncan SA. 2021. GATA6 defines endoderm fate by controlling chromatin accessibility during differentiation of human-induced pluripotent stem cells. Cell Reports 35: 109145.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109145 "},{"reference":"Keyfi F, Talebi S, Varasteh AR. 2016. Methylmalonic Acidemia Diagnosis by Laboratory Methods. Rep Biochem Mol Biol 5(1): 1-14.
","pubmedId":"28070528","doi":""},{"reference":"Ludwig TE, Bergendahl V, Levenstein ME, Yu J, Probasco MD, Thomson JA. 2006. Feeder-independent culture of human embryonic stem cells. Nature Methods 3: 637-646.
","pubmedId":"","doi":"10.1038/nmeth902 "},{"reference":"Ludwig TE, Levenstein ME, Jones JM, Berggren WT, Mitchen ER, Frane JL, et al., Thomson. 2006. Derivation of human embryonic stem cells in defined conditions. Nature Biotechnology 24: 185-187.
","pubmedId":"","doi":"10.1038/nbt1177 "},{"reference":"Mallanna SK, Duncan SA. 2013. Differentiation of Hepatocytes from Pluripotent Stem Cells. Current Protocols in Stem Cell Biology 26: 10.1002/9780470151808.sc01g04s26.
","pubmedId":"","doi":"10.1002/9780470151808.sc01g04s26 "},{"reference":"Musunuru K. 2013. Genome editing of human pluripotent stem cells to generate human cellular disease models. Disease Models & Mechanisms : 10.1242/dmm.012054.
","pubmedId":"","doi":"10.1242/dmm.012054 "},{"reference":"Nagaoka M, Si-Tayeb K, Akaike T, Duncan SA. 2010. Culture of human pluripotent stem cells using completely defined conditions on a recombinant E-cadherin substratum. BMC Developmental Biology 10: 10.1186/1471-213x-10-60.
","pubmedId":"","doi":"10.1186/1471-213X-10-60 "},{"reference":"Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8: 2281-2308.
","pubmedId":"","doi":"10.1038/nprot.2013.143 "},{"reference":"Sen K, Burrage LC, Chapman KA, Ginevic I, Mazariegos GV, Graham BH. 2023. Solid organ transplantation in methylmalonic acidemia and propionic acidemia: A points to consider statement of the American College of Medical Genetics and Genomics (ACMG). Genetics in Medicine 25: 100337.
","pubmedId":"","doi":"10.1016/j.gim.2022.11.005 "},{"reference":"Sénac JS, Chandler RJ, Sysol JR, Li L, Venditti CP. 2011. Gene therapy in a murine model of methylmalonic acidemia using rAAV9-mediated gene delivery. Gene Therapy 19: 385-391.
","pubmedId":"","doi":"10.1038/gt.2011.108 "},{"reference":"Si-Tayeb K, Noto FK, Nagaoka M, Li J, Battle MA, Duris C, et al., Duncan. 2010. Highly Efficient Generation of Human Hepatocyte–Like Cells From Induced Pluripotent Stem Cells. Hepatology 51: 297-305.
","pubmedId":"","doi":"10.1002/hep.23354 "},{"reference":"Si-Tayeb K, Noto FK, Sepac A, Sedlic F, Bosnjak ZJ, Lough JW, Duncan SA. 2010. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding reprogramming factors. BMC Developmental Biology 10: 10.1186/1471-213x-10-81.
","pubmedId":"","doi":"10.1186/1471-213X-10-81 "},{"reference":"Willard HF, Ambani LM, Hart AC, Mahoney MJ, Rosenberg LE. 1976. Rapid prenatal and postnatal detection of inborn errors of propionate, methylmalonate, and cobalamin metabolism: A sensitive assay using cultured cells. Human Genetics 34: 277-283.
","pubmedId":"","doi":"10.1007/BF00295291 "}],"title":"Modeling Inherited Methylmalonic Acidemia Using Isogenic Human Induced Pluripotent Stem Cell-Derived Hepatocytes with Mutations in Methylmalonyl-CoA Mutase
","reviews":[],"curatorReviews":[]},{"id":"fa50c68d-9453-4305-a2f1-3d53effa8d0d","decision":"edit","abstract":"Isolated methylmalonic acidemia (MMA) is an autosomal recessive disorder that increases methylmalonic acid by affecting the metabolism of propionyl-CoA. Mutations in multiple genes cause MMA, however, those in methylmalonyl-CoA mutase (MMUT) are most common. MMUT is an isomerase that converts methylmalonyl-CoA to succinyl-CoA, a key tricarboxylic acid (TCA) cycle intermediate. The defects in these metabolic processes disproportionately affect hepatocytes in patients with MMA. We performed gene editing in human induced pluripotent stem cells (hiPSCs) to generate loss-of-function mutations within MMUT. Hepatocytes derived from these iPSCs recapitulate key aspects of methylmalonic acidemia, providing a new model of MMA.
","acknowledgements":"The Cell Models and Imaging Cores of the MUSC COBRE in Digestive and Liver Disease and the MUSC Digestive Disease Research Core Center supported the project.
","authors":[{"affiliations":["Medical University of South Carolina, Charleston, SC, United States","Citadel, Charleston, SC, United States"],"departments":["Regenerative Medicine and Cell Biology","Department of Biology,"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"pournasr@musc.edu","firstName":"Behshad","lastName":"Pournasr","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Medical University of South Carolina, Charleston, SC, US"],"departments":["Regenerative Medicine and Cell Biology"],"credit":["resources","writing_reviewEditing","conceptualization"],"email":"duncanst@musc.edu","firstName":"Stephen","lastName":"Duncan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2507-7827"}],"awards":[{"awardId":"DK102716","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"DK123704","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Rockey"},{"awardId":"DK119728","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"GM130457","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Duncan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Work was supported by funds from the National Institutes of Health.
","image":{"url":"https://portal.micropublication.org/uploads/30ab404e534f4d027e0a11fe96ca48ee.jpg"},"imageCaption":"(A) Schematic illustration of MMUT gene structure highlighting exon 3, sequence of CRISPR/Cas9 guide (red arrow), position of the PAM element, and the nucleotide sequences of wild-type (MMUT +/+) and mutant alleles (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (B) Image of a polyacrylamide gel displaying MMUT exon 3 amplicons from wild-type control (MMUT +/+) iPSCs and those harboring mutations (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (C) Fluorescent immunostaining of day 20 hepatocytes derived from wild type (MMUT +/+) and mutant iPSC lines (MMUT Ex3Δ17/+2, MMUT Ex3Δ10/+1, MMUTEx3Δ31/+1) for Albumin (Red), HNF4a (green) and Methylmalonyl-CoA Mutase (MUT, Green), scale bars = 100 µM (Albumin and HNF4a) and 80µM (MUT). (D) Western blot analysis to detect Methylmalonyl-CoA Mutase protein (MUT) in either wild-type (MMUT +/+) or mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSC lines. HSP90 served as a loading control. (E) Bar graphs showing the relative levels of 14C precipitated by TCA from protein extracts from day-20 hepatocytes derived from wild-type (MMUT+/+) and mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSCs (left panel). The mean total protein content of the TCA precipitates did not differ significantly across samples (right panel). Data are represented as mean ± SD, n = 3 - 6 biological replicates.
","imageTitle":"Generation and Characterization of MMUT–deficient iPSCs
","methods":"MATERIALS AND METHODS
iPSC Lines and Culture
Human K3 iPSCs were previously reprogrammed from human foreskin fibroblasts (Si-Tayeb, Noto, Sepac, et al., 2010). Pluripotent cells were cultured in low oxygen conditions (37°C, 4% O2, 5% CO2) on an E-cadherin-IgG Fc fusion protein matrix (Nagaoka & Duncan, 2012), using defined mTeSR1 culture medium (Ludwig, Levenstein, et al., 2006) supplemented with zebrafish bFGF (40 ng/ml) (Ludwig, Bergendahl, et al., 2006). MMUTEx3Δ17/+2, MMUTEx3Δ10/+1, and MMUTEx3Δ31/+1 cells were generated through CRISPR/Cas9 gene editing (Ran et al., 2013) (Heslop et al., 2021). Pluripotency was assessed by measuring OCT3/4 (Santa Cruz, USA) expression via flow cytometry using a Guava EasyCyte mini and differentiation to hepatocytes.
CRISPR-mediated gene targeting
CRISPR guide RNAs (gRNAs) targeting exon 3 of the MMUT gene were designed using an algorithm developed by Ran et al. Guide RNA sequences (Forward: CACCGTTTGATCTGGCGACACATCG; AAACCGATGTGTCGCCAGATCAAAC) were cloned into the PX459 pSPCas9(BB)-2A-Puro vector version 2 (Ran et al., 2013). K3 (MMUT+/+) iPSCs were seeded on to a Geltrex-coated (ThermoFisher/Gibco, CA, #A1413302) 10cm2 tissue culture plate at 70-75% confluency. The following day, 60μg of the CRISPR/Cas9 plasmid containing gRNA was introduced into the pluripotent cells by electroporation. After 24 hours, 1 μg/ml of puromycin (Sigma Aldrich, MO, #P9620) was added to the culture medium for 48 hours to select for transfected cells. The surviving cell colonies were expanded, and samples from each were collected after 7-10 days for genomic DNA analyses. Indels were amplified using Herculase Fusion Polymerase (Agilent, CA, #600675), with the primer set (TGGTCAGCAGGGATTATCAG, CAGTGTCAATAGCATCTCCAGC). Amplicons were resolved by polyacrylamide gel electrophoresis using 4%–20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225). Potential INDELs were confirmed by DNA sequencing of amplicons and analyzed using TIDE (Brinkman & van Steensel, 2019).
Differentiation of pluripotent stem cells
iPSCs were differentiated following a previously published protocol (Mallanna & Duncan, 2013). Briefly, cells were plated at 80% confluency on Matrigel-coated tissue culture plates. The next day, the media was replaced with RPMI medium containing B27 minus insulin (ThermoFisher Scientific, NY, #A1895601), Activin A (100 ng/ml; ThermoFisher Scientific, NY, #PHC9563), fibroblast growth factor 2 (FGF2, 20 ng/ml; ThermoFisher Scientific, NY, #PHG0023), and bone morphogenetic protein 4 (BMP4, 10 ng/ml; ThermoFisher Scientific, NY, #PHC9533) for 48 hours with daily media changes. To commit the populations to a definitive endoderm fate, cells were cultured in RPMI medium supplemented with B27 minus insulin and Activin A (100 ng/ml) for 48 hours, with daily media changes. Over the next five days, the cells were treated with B27 Supplement, 10 ng/mL FGF2, and 20 ng/mL BMP4 to convert them from definitive endoderm to hepatic progenitor cells. The cells were then cultured for an additional five days in B27 Supplement and 20 ng/mL Hepatocyte Growth Factor (Invitrogen, MA, #PHG0321) to generate immature hepatocytes. Finally, during the last five days of differentiation, they were induced to mature hepatocyte-like cells by culturing in HCM medium (Lonza, MD, #CC3198) supplemented with 20 ng/mL Oncostatin M (Invitrogen, MA, #PHC5015).
14C propionate fixation assay
The differentiated cells were treated with 14C-propionate at a final concentration of 1 µCi/ml in hepatocyte medium overnight. The next day, both treated and untreated cells were enzymatically harvested with 0.25% trypsin-EDTA for 10 minutes at 37 °C after at two washes with PBS. The final pellet was resuspended in 5% TCA and incubated on ice for 30 minutes. The supernatant was removed by centrifugation, and 1N NaOH was added to make the samples soluble and ready for measurement of 14C incorporation using a Beckman Coulter 156500 scintillation counter (Willard et al., 1976).
Immunofluorescence
Cells were differentiated, washed once with PBS, and fixed with 4% paraformaldehyde (w/v; Santa Cruz, TX, #sc-281692) for 20 minutes. After washing the samples three times with PBS, they were permeabilized using 0.4% Triton X-100 for 20 minutes. Then, 3% BSA (w/v) in PBS was added for 1 hour to block the samples. The blocking solution was removed, and primary antibodies were applied and incubated overnight at 4°C in 1% BSA (w/v). The antibodies used included HNF4A (Santa Cruz, #sc-6556, 1:100) and Albumin (Cedarlane, #CL2513A, 1:500). The next day, the cells were washed three times with 1% BSA (w/v) in PBS and stained with DAPI (1 μg/ml; Sigma Aldrich, MO, #D1388) and AlexaFluor488 or AlexaFluor594 conjugated secondary antibodies (1:1000; ThermoFisher Scientific, NY) for 2 hours at room temperature. After three PBS washes, imaging was performed using a ZOE fluorescent cell imager (BioRad, CA). All images were processed identically.
Immunoblotting
Cell lysates were collected using 1x RIPA buffer (Millipore, MA, #20-188) containing HALT protease inhibitor cocktail (ThermoFisher Scientific, NY, #78443) after washing the cells with PBS. Protein content was determined by a BCA assay (ThermoFisher/Pierce, IL, #23227). 10-30 μg of total protein was separated by SDS–PAGE in 4%–15% Mini-Protean TGX stain-free precast gels (BioRad, CA, #4568184). Separated proteins were transferred to PVDF membranes using the Trans-Blot Turbo Transfer System (BioRad, CA, #1704155). Membranes were blocked with 5% BSA (w/v) in TBS with 0.1% Tween (TBS-T) for one hour at room temperature. They were incubated overnight in 1% BSA in TBS-T at 4°C with antibodies against MUT (Santa Cruz, #sc-390978, 1:200) and HSP90b (Abcam, #ab32568, 1:100000). The next day, membranes were washed with 1% BSA (w/v) in TBS-T and then incubated with HRP-conjugated secondary antibodies for 2 hours at room temperature, followed by three washes with TBS-T. Clarity chemiluminescent reagent (BioRad, CA, #1705061) was applied for 1-5 minutes. Blot images were captured using the Chemidoc Touch gel imager (BioRad, CA).
Quantitative Real-Time PCR Analysis
RNA was isolated using the RNeasy Mini Kit following the manufacturer’s instructions (QIAGEN, #74106). RNA was treated with TURBO DNase (ThermoFisher/Ambion, NY, #AM1907) on column during RNA extraction. M-MLV Reverse Transcriptase (ThermoFisher/Invitrogen, NY, #28025-013) was used to generate cDNA. Quantitative real-time PCR (qRT-PCR) analysis was performed on a CFX384 real-time PCR machine (BioRad, CA) using TaqMan® Gene Expression assays (ThermoFisher/Applied Biosystems, NY, #4369016). Primer sets were purchased from Integrated DNA Technologies (Integrated DNA Technologies, IA).
Quantification and statistical analysis
Graphs were generated using Microsoft Excel or GraphPad Prism. Statistical analyses were performed using GraphPad Prism 8. For all analyses, experiments were performed in at least three independent biological replicates (n = independent biological replicates). Statistical significance between iPSC-derived cell lines was assessed using one-way ANOVA followed by Tukey’s post hoc multiple comparisons test.
","reagents":"","patternDescription":"DESCRIPTION
Methylmalonic acidemia (MMA) is an autosomal recessive disorder of the metabolism of branched-chain amino acids. It has been estimated that between 60-70% of MMA cases are caused by mutations in the MMUT gene that encodes the mitochondrial enzyme methylmalonyl-CoA mutase. (Habibzadeh et al., 2020). This enzyme catalyzes the conversion of methylmalonyl-CoA to succinyl-CoA (Fraser & Venditti, 2016). Affected patients fail to thrive and suffer from various clinical complications, including metabolic stroke, end-stage liver and renal failure, seizures, and developmental delays (Caterino et al., 2016) (Keyfi et al., 2016). Current treatments focus on limiting exposure to branched-chain amino acids through low-protein diets; however, these treatments fail to prevent substantial morbidity and mortality (Fraser & Venditti, 2016). Recent advances in mRNA (An et al., 2017) and gene therapy in animal models show some promise (Chandler & Venditti, 2019) (Senac et al., 2012); Unfortunately, for severely affected patients, liver transplants are the only beneficial option (Sen et al., 2023). The limitations of available therapeutics reflect a lack of models suitable for studying the molecular mechanisms of MMA and for identifying therapeutics (Hansen & Horslen, 2008). Although some mouse models of MMA can survive long-term (Chandler et al., 2022), differences between mice and humans limit their value. Human pluripotent stem cells that can be induced to differentiate into hepatocytes (Si-Tayeb, Noto, Nagaoka, et al., 2010) (Mallanna & Duncan, 2013) offer considerable potential as an alternative to rodents for modeling rare inborn errors in human metabolism (Musunuru, 2013) and as a platform for drug discovery.
We used CRISPR/Cas9 genome editing (Figure 1A) to generate a series of isogenic iPSCs harboring an MMUT gene mutation. A CRISPR guide RNA was designed to target exon 3 of MMUT, ensuring that any resulting frameshift mutations would inactivate enzyme activity, which is encoded by exons 8-12. Clonal cell lines were established and confirmed to express pluripotency markers via flow cytometry. PCR analyses (Figure 1B) and DNA sequencing (Figure 1A) were used to identify mutations. Three independent compound heterozygous lines were retained: MMUTEx3∆17/+2, has a 17-base pair deletion in one allele and a 2-base pair insertion in the other; MMUTEx3Δ10/+1, has a 10-base pair deletion and a 1-base pair insertion; and MMUTEx3Δ31/+1, has a 31-base pair deletion and a 1-base pair insertion. All alleles were predicted to cause frameshifts leading to premature stop codons downstream of Exon 3: MMUTEx3∆17/+2 (p.Phe138SerfsTer141; Arg144PhefsTer180), MMUTEx3Δ10/+1 (p.Ala141ValfsTer176; His143GlnfsTer147), and MMUTEx3Δ31/+1 (p.Ala137ValfsTer167; Arg144SerfsTer147).
We compared the ability of MMUT-deficient and control MMUT+/+ iPSCs to differentiate into hepatocyte-like cells using our standard protocol, as previously described in detail (Si-Tayeb, Noto, Nagaoka, et al., 2010). After 20 days of differentiation, immunostaining showed that all cells strongly expressed characteristic hepatocyte markers, including Albumin and the transcription factor HNF4a (Figure 1C). Moreover, an anti-methylmalonase mutase antibody stained MUT+/+ iPSC-derived hepatocytes, but no signal was detected in any of the mutant cells. We finally evaluated the effect of the mutations on MUT protein expression using immunoblot analysis. Figure 1D shows that the MUT protein was highly expressed in control cells but was undetectable in all three MMUT-disrupted lines (Figure 1D), consistent with predictions from DNA sequence analysis and the immunostaining experiments.
We next performed a 14C-propionate fixation assay to determine whether mutations in MMUT restricted propionate metabolism. The 14C-propionate fixation assay is a sensitive, reliable, and straightforward method for detecting inborn errors of propionate, methylmalonate, and cobalamin metabolism. This test is often employed to confirm MMA clinically, especially when genetic evidence is lacking (Forny et al., 2021). It works by providing 14C-propionate to cells that rely on methylmalonyl-CoA mutase to facilitate the incorporation (fixation) of 14C into acid-precipitable materials, including organic acids, amino acids, and proteins through the TCA cycle. Figure 1E shows that, although total protein levels were similar across all cells, 14C fixation was markedly and significantly reduced in all three methylmalonyl-CoA mutase-deficient cells compared to the parental control MMUT+/+ cells.
In summary, MMA is a serious disease caused by defects in the liver's ability to process branched-chain amino acids. Our data describe the creation of human iPSCs with mutations in the MMUT gene, which is the most common cause of MMA. We suggest that such cells could serve as a platform to better understand the role of hepatocytes in MMA and to help discover new treatments.
","references":[{"reference":"An D, Schneller JL, Frassetto A, Liang S, Zhu X, Park JS, et al., Martini. 2017. Systemic Messenger RNA Therapy as a Treatment for Methylmalonic Acidemia. Cell Reports 21: 3548-3558.
","pubmedId":"","doi":"10.1016/j.celrep.2017.11.081 "},{"reference":"Brinkman EK, van Steensel B. 2019. Rapid Quantitative Evaluation of CRISPR Genome Editing by TIDE and TIDER. Methods in Molecular Biology,CRISPR Gene Editing : 29-44.
","pubmedId":"","doi":"10.1007/978-1-4939-9170-9_3 "},{"reference":"Caterino M, Chandler RJ, Sloan JL, Dorko K, Cusmano-Ozog K, Ingenito L, et al., Ruoppolo. 2015. The proteome of methylmalonic acidemia (MMA): the elucidation of altered pathways in patient livers. Molecular BioSystems 12: 566-574.
","pubmedId":"","doi":"10.1039/c5mb00736d "},{"reference":"Chandler RJ, Di Pasquale G, Sloan JL, McCoy S, Hubbard BT, Kilts TM, et al., Venditti. 2022. Systemic gene therapy for methylmalonic acidemia using the novel adeno-associated viral vector 44.9. Molecular Therapy - Methods & Clinical Development 27: 61-72.
","pubmedId":"","doi":"10.1016/j.omtm.2022.09.001 "},{"reference":"Chandler RJ, Venditti CP. 2019. Gene Therapy for Methylmalonic Acidemia: Past, Present, and Future. Human Gene Therapy 30: 1236-1244.
","pubmedId":"","doi":"10.1089/hum.2019.113 "},{"reference":"Forny P, Hörster F, Ballhausen D, Chakrapani A, Chapman KA, Dionisi‐Vici C, et al., Baumgartner. 2021. Guidelines for the diagnosis and management of methylmalonic acidaemia and propionic acidaemia: First revision. Journal of Inherited Metabolic Disease 44: 566-592.
","pubmedId":"","doi":"10.1002/jimd.12370 "},{"reference":"Fraser JL, Venditti CP. 2016. Methylmalonic and propionic acidemias: clinical management update. Current Opinion in Pediatrics 28: 682-693.
","pubmedId":"","doi":"10.1097/MOP.0000000000000422 "},{"reference":"Habibzadeh P, Tabatabaei Z, Farazi Fard MA, Jamali L, Hafizi A, Nikuei P, et al., Faghihi. 2020. Pre-implantation genetic diagnosis in an Iranian family with a novel mutation in MUT gene. BMC Medical Genetics 21: 10.1186/s12881-020-0959-8.
","pubmedId":"","doi":"10.1186/s12881-020-0959-8 "},{"reference":"Hansen K, Horslen S. 2008. Metabolic liver disease in children. Liver Transplantation 14: 713-733.
","pubmedId":"","doi":"10.1002/lt.21520 "},{"reference":"Heslop JA, Pournasr B, Liu JT, Duncan SA. 2021. GATA6 defines endoderm fate by controlling chromatin accessibility during differentiation of human-induced pluripotent stem cells. Cell Reports 35: 109145.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109145 "},{"reference":"Keyfi F, Talebi S, Varasteh AR. 2016. Methylmalonic Acidemia Diagnosis by Laboratory Methods. Rep Biochem Mol Biol 5(1): 1-14.
","pubmedId":"28070528","doi":""},{"reference":"Ludwig TE, Bergendahl V, Levenstein ME, Yu J, Probasco MD, Thomson JA. 2006. Feeder-independent culture of human embryonic stem cells. Nature Methods 3: 637-646.
","pubmedId":"","doi":"10.1038/nmeth902 "},{"reference":"Ludwig TE, Levenstein ME, Jones JM, Berggren WT, Mitchen ER, Frane JL, et al., Thomson. 2006. Derivation of human embryonic stem cells in defined conditions. Nature Biotechnology 24: 185-187.
","pubmedId":"","doi":"10.1038/nbt1177 "},{"reference":"Mallanna SK, Duncan SA. 2013. Differentiation of Hepatocytes from Pluripotent Stem Cells. Current Protocols in Stem Cell Biology 26: 10.1002/9780470151808.sc01g04s26.
","pubmedId":"","doi":"10.1002/9780470151808.sc01g04s26 "},{"reference":"Musunuru K. 2013. Genome editing of human pluripotent stem cells to generate human cellular disease models. Disease Models & Mechanisms : 10.1242/dmm.012054.
","pubmedId":"","doi":"10.1242/dmm.012054 "},{"reference":"Nagaoka M, Si-Tayeb K, Akaike T, Duncan SA. 2010. Culture of human pluripotent stem cells using completely defined conditions on a recombinant E-cadherin substratum. BMC Developmental Biology 10: 10.1186/1471-213x-10-60.
","pubmedId":"","doi":"10.1186/1471-213X-10-60 "},{"reference":"Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8: 2281-2308.
","pubmedId":"","doi":"10.1038/nprot.2013.143 "},{"reference":"Sen K, Burrage LC, Chapman KA, Ginevic I, Mazariegos GV, Graham BH. 2023. Solid organ transplantation in methylmalonic acidemia and propionic acidemia: A points to consider statement of the American College of Medical Genetics and Genomics (ACMG). Genetics in Medicine 25: 100337.
","pubmedId":"","doi":"10.1016/j.gim.2022.11.005 "},{"reference":"Sénac JS, Chandler RJ, Sysol JR, Li L, Venditti CP. 2011. Gene therapy in a murine model of methylmalonic acidemia using rAAV9-mediated gene delivery. Gene Therapy 19: 385-391.
","pubmedId":"","doi":"10.1038/gt.2011.108 "},{"reference":"Si-Tayeb K, Noto FK, Nagaoka M, Li J, Battle MA, Duris C, et al., Duncan. 2010. Highly Efficient Generation of Human Hepatocyte–Like Cells From Induced Pluripotent Stem Cells. Hepatology 51: 297-305.
","pubmedId":"","doi":"10.1002/hep.23354 "},{"reference":"Si-Tayeb K, Noto FK, Sepac A, Sedlic F, Bosnjak ZJ, Lough JW, Duncan SA. 2010. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding reprogramming factors. BMC Developmental Biology 10: 10.1186/1471-213x-10-81.
","pubmedId":"","doi":"10.1186/1471-213X-10-81 "},{"reference":"Willard HF, Ambani LM, Hart AC, Mahoney MJ, Rosenberg LE. 1976. Rapid prenatal and postnatal detection of inborn errors of propionate, methylmalonate, and cobalamin metabolism: A sensitive assay using cultured cells. Human Genetics 34: 277-283.
","pubmedId":"","doi":"10.1007/BF00295291 "}],"title":"Modeling Inherited Methylmalonic Acidemia Using Isogenic Human Induced Pluripotent Stem Cell-Derived Hepatocytes with Mutations in Methylmalonyl-CoA Mutase
","reviews":[],"curatorReviews":[]},{"id":"5496232b-3cc9-4318-b53e-6d53135aed77","decision":"publish","abstract":"Isolated methylmalonic acidemia (MMA) is an autosomal recessive disorder that increases methylmalonic acid by affecting the metabolism of propionyl-CoA. Mutations in multiple genes cause MMA, however, those in methylmalonyl-CoA mutase (MMUT) are most common. MMUT is an isomerase that converts methylmalonyl-CoA to succinyl-CoA, a key tricarboxylic acid (TCA) cycle intermediate. The defects in these metabolic processes disproportionately affect hepatocytes in patients with MMA. We performed gene editing in human induced pluripotent stem cells (hiPSCs) to generate loss-of-function mutations within MMUT. Hepatocytes derived from these iPSCs recapitulate key aspects of methylmalonic acidemia, providing a new model of MMA.
","acknowledgements":"The Cell Models and Imaging Cores of the MUSC COBRE in Digestive and Liver Disease and the MUSC Digestive Disease Research Core Center supported the project.
","authors":[{"affiliations":["Medical University of South Carolina, Charleston, SC, United States","Citadel, Charleston, SC, United States"],"departments":["Regenerative Medicine and Cell Biology","Department of Biology,"],"credit":["formalAnalysis","investigation","writing_originalDraft","writing_reviewEditing","conceptualization"],"email":"pournasr@musc.edu","firstName":"Behshad","lastName":"Pournasr","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Medical University of South Carolina, Charleston, SC, US"],"departments":["Regenerative Medicine and Cell Biology"],"credit":["resources","writing_reviewEditing","conceptualization"],"email":"duncanst@musc.edu","firstName":"Stephen","lastName":"Duncan","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0002-2507-7827"}],"awards":[{"awardId":"DK102716","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"DK123704","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Rockey"},{"awardId":"DK119728","funderName":"National Institute of Diabetes and Digestive and Kidney Diseases (United States)","awardRecipient":"Duncan"},{"awardId":"GM130457","funderName":"National Institute of General Medical Sciences (United States)","awardRecipient":"Duncan"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"Work was supported by funds from the National Institutes of Health.
","image":{"url":"https://portal.micropublication.org/uploads/30ab404e534f4d027e0a11fe96ca48ee.jpg"},"imageCaption":"(A) Schematic illustration of MMUT gene structure highlighting exon 3, sequence of CRISPR/Cas9 guide (red arrow), position of the PAM element, and the nucleotide sequences of wild-type (MMUT +/+) and mutant alleles (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (B) Image of a polyacrylamide gel displaying MMUT exon 3 amplicons from wild-type control (MMUT +/+) iPSCs and those harboring mutations (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1). (C) Fluorescent immunostaining of day 20 hepatocytes derived from wild type (MMUT +/+) and mutant iPSC lines (MMUT Ex3Δ17/+2, MMUT Ex3Δ10/+1, MMUTEx3Δ31/+1) for Albumin (Red), HNF4a (green) and Methylmalonyl-CoA Mutase (MUT, Green), scale bars = 100 µM (Albumin and HNF4a) and 80µM (MUT). (D) Western blot analysis to detect Methylmalonyl-CoA Mutase protein (MUT) in either wild-type (MMUT +/+) or mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSC lines. HSP90 served as a loading control. (E) Bar graphs showing the relative levels of 14C precipitated by TCA from protein extracts from day-20 hepatocytes derived from wild-type (MMUT+/+) and mutant (MMUTEX3Δ17/+2, MMUT EX3Δ10/+1, and MMUTEX3Δ31/+1) iPSCs (left panel). The mean total protein content of the TCA precipitates did not differ significantly across samples (right panel). Data are represented as mean ± SD, n = 3 - 6 biological replicates.
","imageTitle":"Generation and Characterization of MMUT–deficient iPSCs
","methods":"iPSC Lines and Culture
Human K3 iPSCs were previously reprogrammed from human foreskin fibroblasts (Si-Tayeb, Noto, Sepac, et al., 2010). Pluripotent cells were cultured in low oxygen conditions (37°C, 4% O2, 5% CO2) on an E-cadherin-IgG Fc fusion protein matrix (Nagaoka & Duncan, 2012), using defined mTeSR1 culture medium (Ludwig, Levenstein, et al., 2006) supplemented with zebrafish bFGF (40 ng/ml) (Ludwig, Bergendahl, et al., 2006). MMUTEx3Δ17/+2, MMUTEx3Δ10/+1, and MMUTEx3Δ31/+1 cells were generated through CRISPR/Cas9 gene editing (Ran et al., 2013) (Heslop et al., 2021). Pluripotency was assessed by measuring OCT3/4 (Santa Cruz, USA) expression via flow cytometry using a Guava EasyCyte mini and differentiation to hepatocytes.
CRISPR-mediated gene targeting
CRISPR guide RNAs (gRNAs) targeting exon 3 of the MMUT gene were designed using an algorithm developed by Ran et al. Guide RNA sequences (Forward: CACCGTTTGATCTGGCGACACATCG; AAACCGATGTGTCGCCAGATCAAAC) were cloned into the PX459 pSPCas9(BB)-2A-Puro vector version 2 (Ran et al., 2013). K3 (MMUT+/+) iPSCs were seeded on to a Geltrex-coated (ThermoFisher/Gibco, CA, #A1413302) 10cm2 tissue culture plate at 70-75% confluency. The following day, 60μg of the CRISPR/Cas9 plasmid containing gRNA was introduced into the pluripotent cells by electroporation. After 24 hours, 1 μg/ml of puromycin (Sigma Aldrich, MO, #P9620) was added to the culture medium for 48 hours to select for transfected cells. The surviving cell colonies were expanded, and samples from each were collected after 7-10 days for genomic DNA analyses. Indels were amplified using Herculase Fusion Polymerase (Agilent, CA, #600675), with the primer set (TGGTCAGCAGGGATTATCAG, CAGTGTCAATAGCATCTCCAGC). Amplicons were resolved by polyacrylamide gel electrophoresis using 4%–20% TBE gels (ThermoFisher/Invitrogen, CA, #EC6225). Potential INDELs were confirmed by DNA sequencing of amplicons and analyzed using TIDE (Brinkman & van Steensel, 2019).
Differentiation of pluripotent stem cells
iPSCs were differentiated following a previously published protocol (Mallanna & Duncan, 2013). Briefly, cells were plated at 80% confluency on Matrigel-coated tissue culture plates. The next day, the media was replaced with RPMI medium containing B27 minus insulin (ThermoFisher Scientific, NY, #A1895601), Activin A (100 ng/ml; ThermoFisher Scientific, NY, #PHC9563), fibroblast growth factor 2 (FGF2, 20 ng/ml; ThermoFisher Scientific, NY, #PHG0023), and bone morphogenetic protein 4 (BMP4, 10 ng/ml; ThermoFisher Scientific, NY, #PHC9533) for 48 hours with daily media changes. To commit the populations to a definitive endoderm fate, cells were cultured in RPMI medium supplemented with B27 minus insulin and Activin A (100 ng/ml) for 48 hours, with daily media changes. Over the next five days, the cells were treated with B27 Supplement, 10 ng/mL FGF2, and 20 ng/mL BMP4 to convert them from definitive endoderm to hepatic progenitor cells. The cells were then cultured for an additional five days in B27 Supplement and 20 ng/mL Hepatocyte Growth Factor (Invitrogen, MA, #PHG0321) to generate immature hepatocytes. Finally, during the last five days of differentiation, they were induced to mature hepatocyte-like cells by culturing in HCM medium (Lonza, MD, #CC3198) supplemented with 20 ng/mL Oncostatin M (Invitrogen, MA, #PHC5015).
14C propionate fixation assay
The differentiated cells were treated with 14C-propionate at a final concentration of 1 µCi/ml in hepatocyte medium overnight. The next day, both treated and untreated cells were enzymatically harvested with 0.25% trypsin-EDTA for 10 minutes at 37 °C after at two washes with PBS. The final pellet was resuspended in 5% TCA and incubated on ice for 30 minutes. The supernatant was removed by centrifugation, and 1N NaOH was added to make the samples soluble and ready for measurement of 14C incorporation using a Beckman Coulter 156500 scintillation counter (Willard et al., 1976).
Immunofluorescence
Cells were differentiated, washed once with PBS, and fixed with 4% paraformaldehyde (w/v; Santa Cruz, TX, #sc-281692) for 20 minutes. After washing the samples three times with PBS, they were permeabilized using 0.4% Triton X-100 for 20 minutes. Then, 3% BSA (w/v) in PBS was added for 1 hour to block the samples. The blocking solution was removed, and primary antibodies were applied and incubated overnight at 4°C in 1% BSA (w/v). The antibodies used included HNF4A (Santa Cruz, #sc-6556, 1:100) and Albumin (Cedarlane, #CL2513A, 1:500). The next day, the cells were washed three times with 1% BSA (w/v) in PBS and stained with DAPI (1 μg/ml; Sigma Aldrich, MO, #D1388) and AlexaFluor488 or AlexaFluor594 conjugated secondary antibodies (1:1000; ThermoFisher Scientific, NY) for 2 hours at room temperature. After three PBS washes, imaging was performed using a ZOE fluorescent cell imager (BioRad, CA). All images were processed identically.
Immunoblotting
Cell lysates were collected using 1x RIPA buffer (Millipore, MA, #20-188) containing HALT protease inhibitor cocktail (ThermoFisher Scientific, NY, #78443) after washing the cells with PBS. Protein content was determined by a BCA assay (ThermoFisher/Pierce, IL, #23227). 10-30 μg of total protein was separated by SDS–PAGE in 4%–15% Mini-Protean TGX stain-free precast gels (BioRad, CA, #4568184). Separated proteins were transferred to PVDF membranes using the Trans-Blot Turbo Transfer System (BioRad, CA, #1704155). Membranes were blocked with 5% BSA (w/v) in TBS with 0.1% Tween (TBS-T) for one hour at room temperature. They were incubated overnight in 1% BSA in TBS-T at 4°C with antibodies against MUT (Santa Cruz, #sc-390978, 1:200) and HSP90b (Abcam, #ab32568, 1:100000). The next day, membranes were washed with 1% BSA (w/v) in TBS-T and then incubated with HRP-conjugated secondary antibodies for 2 hours at room temperature, followed by three washes with TBS-T. Clarity chemiluminescent reagent (BioRad, CA, #1705061) was applied for 1-5 minutes. Blot images were captured using the Chemidoc Touch gel imager (BioRad, CA).
Quantitative Real-Time PCR Analysis
RNA was isolated using the RNeasy Mini Kit following the manufacturer’s instructions (QIAGEN, #74106). RNA was treated with TURBO DNase (ThermoFisher/Ambion, NY, #AM1907) on column during RNA extraction. M-MLV Reverse Transcriptase (ThermoFisher/Invitrogen, NY, #28025-013) was used to generate cDNA. Quantitative real-time PCR (qRT-PCR) analysis was performed on a CFX384 real-time PCR machine (BioRad, CA) using TaqMan® Gene Expression assays (ThermoFisher/Applied Biosystems, NY, #4369016). Primer sets were purchased from Integrated DNA Technologies (Integrated DNA Technologies, IA).
Quantification and statistical analysis
Graphs were generated using Microsoft Excel or GraphPad Prism. Statistical analyses were performed using GraphPad Prism 8. For all analyses, experiments were performed in at least three independent biological replicates (n = independent biological replicates). Statistical significance between iPSC-derived cell lines was assessed using one-way ANOVA followed by Tukey’s post hoc multiple comparisons test.
","reagents":"","patternDescription":"Methylmalonic acidemia (MMA) is an autosomal recessive disorder of the metabolism of branched-chain amino acids. It has been estimated that between 60-70% of MMA cases are caused by mutations in the MMUT gene that encodes the mitochondrial enzyme methylmalonyl-CoA mutase. (Habibzadeh et al., 2020). This enzyme catalyzes the conversion of methylmalonyl-CoA to succinyl-CoA (Fraser & Venditti, 2016). Affected patients fail to thrive and suffer from various clinical complications, including metabolic stroke, end-stage liver and renal failure, seizures, and developmental delays (Caterino et al., 2016) (Keyfi et al., 2016). Current treatments focus on limiting exposure to branched-chain amino acids through low-protein diets; however, these treatments fail to prevent substantial morbidity and mortality (Fraser & Venditti, 2016). Recent advances in mRNA (An et al., 2017) and gene therapy in animal models show some promise (Chandler & Venditti, 2019) (Senac et al., 2012); Unfortunately, for severely affected patients, liver transplants are the only beneficial option (Sen et al., 2023). The limitations of available therapeutics reflect a lack of models suitable for studying the molecular mechanisms of MMA and for identifying therapeutics (Hansen & Horslen, 2008). Although some mouse models of MMA can survive long-term (Chandler et al., 2022), differences between mice and humans limit their value. Human pluripotent stem cells that can be induced to differentiate into hepatocytes (Si-Tayeb, Noto, Nagaoka, et al., 2010) (Mallanna & Duncan, 2013) offer considerable potential as an alternative to rodents for modeling rare inborn errors in human metabolism (Musunuru, 2013) and as a platform for drug discovery.
We used CRISPR/Cas9 genome editing (Figure 1A) to generate a series of isogenic iPSCs harboring an MMUT gene mutation. A CRISPR guide RNA was designed to target exon 3 of MMUT, ensuring that any resulting frameshift mutations would inactivate enzyme activity, which is encoded by exons 8-12. Clonal cell lines were established and confirmed to express pluripotency markers via flow cytometry. PCR analyses (Figure 1B) and DNA sequencing (Figure 1A) were used to identify mutations. Three independent compound heterozygous lines were retained: MMUTEx3∆17/+2, has a 17-base pair deletion in one allele and a 2-base pair insertion in the other; MMUTEx3Δ10/+1, has a 10-base pair deletion and a 1-base pair insertion; and MMUTEx3Δ31/+1, has a 31-base pair deletion and a 1-base pair insertion. All alleles were predicted to cause frameshifts leading to premature stop codons downstream of Exon 3: MMUTEx3∆17/+2 (p.Phe138SerfsTer141; Arg144PhefsTer180), MMUTEx3Δ10/+1 (p.Ala141ValfsTer176; His143GlnfsTer147), and MMUTEx3Δ31/+1 (p.Ala137ValfsTer167; Arg144SerfsTer147).
We compared the ability of MMUT-deficient and control MMUT+/+ iPSCs to differentiate into hepatocyte-like cells using our standard protocol, as previously described in detail (Si-Tayeb, Noto, Nagaoka, et al., 2010). After 20 days of differentiation, immunostaining showed that all cells strongly expressed characteristic hepatocyte markers, including Albumin and the transcription factor HNF4a (Figure 1C). Moreover, an anti-methylmalonase mutase antibody stained MUT+/+ iPSC-derived hepatocytes, but no signal was detected in any of the mutant cells. We finally evaluated the effect of the mutations on MUT protein expression using immunoblot analysis. Figure 1D shows that the MUT protein was highly expressed in control cells but was undetectable in all three MMUT-disrupted lines (Figure 1D), consistent with predictions from DNA sequence analysis and the immunostaining experiments.
We next performed a 14C-propionate fixation assay to determine whether mutations in MMUT restricted propionate metabolism. The 14C-propionate fixation assay is a sensitive, reliable, and straightforward method for detecting inborn errors of propionate, methylmalonate, and cobalamin metabolism. This test is often employed to confirm MMA clinically, especially when genetic evidence is lacking (Forny et al., 2021). It works by providing 14C-propionate to cells that rely on methylmalonyl-CoA mutase to facilitate the incorporation (fixation) of 14C into acid-precipitable materials, including organic acids, amino acids, and proteins through the TCA cycle. Figure 1E shows that, although total protein levels were similar across all cells, 14C fixation was markedly and significantly reduced in all three methylmalonyl-CoA mutase-deficient cells compared to the parental control MMUT+/+ cells.
In summary, MMA is a serious disease caused by defects in the liver's ability to process branched-chain amino acids. Our data describe the creation of human iPSCs with mutations in the MMUT gene, which is the most common cause of MMA. We suggest that such cells could serve as a platform to better understand the role of hepatocytes in MMA and to help discover new treatments.
","references":[{"reference":"An D, Schneller JL, Frassetto A, Liang S, Zhu X, Park JS, et al., Martini. 2017. Systemic Messenger RNA Therapy as a Treatment for Methylmalonic Acidemia. Cell Reports 21: 3548-3558.
","pubmedId":"","doi":"10.1016/j.celrep.2017.11.081 "},{"reference":"Brinkman EK, van Steensel B. 2019. Rapid Quantitative Evaluation of CRISPR Genome Editing by TIDE and TIDER. Methods in Molecular Biology,CRISPR Gene Editing : 29-44.
","pubmedId":"","doi":"10.1007/978-1-4939-9170-9_3 "},{"reference":"Caterino M, Chandler RJ, Sloan JL, Dorko K, Cusmano-Ozog K, Ingenito L, et al., Ruoppolo. 2015. The proteome of methylmalonic acidemia (MMA): the elucidation of altered pathways in patient livers. Molecular BioSystems 12: 566-574.
","pubmedId":"","doi":"10.1039/c5mb00736d "},{"reference":"Chandler RJ, Di Pasquale G, Sloan JL, McCoy S, Hubbard BT, Kilts TM, et al., Venditti. 2022. Systemic gene therapy for methylmalonic acidemia using the novel adeno-associated viral vector 44.9. Molecular Therapy - Methods & Clinical Development 27: 61-72.
","pubmedId":"","doi":"10.1016/j.omtm.2022.09.001 "},{"reference":"Chandler RJ, Venditti CP. 2019. Gene Therapy for Methylmalonic Acidemia: Past, Present, and Future. Human Gene Therapy 30: 1236-1244.
","pubmedId":"","doi":"10.1089/hum.2019.113 "},{"reference":"Forny P, Hörster F, Ballhausen D, Chakrapani A, Chapman KA, Dionisi‐Vici C, et al., Baumgartner. 2021. Guidelines for the diagnosis and management of methylmalonic acidaemia and propionic acidaemia: First revision. Journal of Inherited Metabolic Disease 44: 566-592.
","pubmedId":"","doi":"10.1002/jimd.12370 "},{"reference":"Fraser JL, Venditti CP. 2016. Methylmalonic and propionic acidemias: clinical management update. Current Opinion in Pediatrics 28: 682-693.
","pubmedId":"","doi":"10.1097/MOP.0000000000000422 "},{"reference":"Habibzadeh P, Tabatabaei Z, Farazi Fard MA, Jamali L, Hafizi A, Nikuei P, et al., Faghihi. 2020. Pre-implantation genetic diagnosis in an Iranian family with a novel mutation in MUT gene. BMC Medical Genetics 21: 10.1186/s12881-020-0959-8.
","pubmedId":"","doi":"10.1186/s12881-020-0959-8 "},{"reference":"Hansen K, Horslen S. 2008. Metabolic liver disease in children. Liver Transplantation 14: 713-733.
","pubmedId":"","doi":"10.1002/lt.21520 "},{"reference":"Heslop JA, Pournasr B, Liu JT, Duncan SA. 2021. GATA6 defines endoderm fate by controlling chromatin accessibility during differentiation of human-induced pluripotent stem cells. Cell Reports 35: 109145.
","pubmedId":"","doi":"10.1016/j.celrep.2021.109145 "},{"reference":"Keyfi F, Talebi S, Varasteh AR. 2016. Methylmalonic Acidemia Diagnosis by Laboratory Methods. Rep Biochem Mol Biol 5(1): 1-14.
","pubmedId":"28070528","doi":""},{"reference":"Ludwig TE, Bergendahl V, Levenstein ME, Yu J, Probasco MD, Thomson JA. 2006. Feeder-independent culture of human embryonic stem cells. Nature Methods 3: 637-646.
","pubmedId":"","doi":"10.1038/nmeth902 "},{"reference":"Ludwig TE, Levenstein ME, Jones JM, Berggren WT, Mitchen ER, Frane JL, et al., Thomson. 2006. Derivation of human embryonic stem cells in defined conditions. Nature Biotechnology 24: 185-187.
","pubmedId":"","doi":"10.1038/nbt1177 "},{"reference":"Mallanna SK, Duncan SA. 2013. Differentiation of Hepatocytes from Pluripotent Stem Cells. Current Protocols in Stem Cell Biology 26: 10.1002/9780470151808.sc01g04s26.
","pubmedId":"","doi":"10.1002/9780470151808.sc01g04s26 "},{"reference":"Musunuru K. 2013. Genome editing of human pluripotent stem cells to generate human cellular disease models. Disease Models & Mechanisms : 10.1242/dmm.012054.
","pubmedId":"","doi":"10.1242/dmm.012054 "},{"reference":"Nagaoka M, Si-Tayeb K, Akaike T, Duncan SA. 2010. Culture of human pluripotent stem cells using completely defined conditions on a recombinant E-cadherin substratum. BMC Developmental Biology 10: 10.1186/1471-213x-10-60.
","pubmedId":"","doi":"10.1186/1471-213X-10-60 "},{"reference":"Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F. 2013. Genome engineering using the CRISPR-Cas9 system. Nature Protocols 8: 2281-2308.
","pubmedId":"","doi":"10.1038/nprot.2013.143 "},{"reference":"Sen K, Burrage LC, Chapman KA, Ginevic I, Mazariegos GV, Graham BH. 2023. Solid organ transplantation in methylmalonic acidemia and propionic acidemia: A points to consider statement of the American College of Medical Genetics and Genomics (ACMG). Genetics in Medicine 25: 100337.
","pubmedId":"","doi":"10.1016/j.gim.2022.11.005 "},{"reference":"Sénac JS, Chandler RJ, Sysol JR, Li L, Venditti CP. 2011. Gene therapy in a murine model of methylmalonic acidemia using rAAV9-mediated gene delivery. Gene Therapy 19: 385-391.
","pubmedId":"","doi":"10.1038/gt.2011.108 "},{"reference":"Si-Tayeb K, Noto FK, Nagaoka M, Li J, Battle MA, Duris C, et al., Duncan. 2010. Highly Efficient Generation of Human Hepatocyte–Like Cells From Induced Pluripotent Stem Cells. Hepatology 51: 297-305.
","pubmedId":"","doi":"10.1002/hep.23354 "},{"reference":"Si-Tayeb K, Noto FK, Sepac A, Sedlic F, Bosnjak ZJ, Lough JW, Duncan SA. 2010. Generation of human induced pluripotent stem cells by simple transient transfection of plasmid DNA encoding reprogramming factors. BMC Developmental Biology 10: 10.1186/1471-213x-10-81.
","pubmedId":"","doi":"10.1186/1471-213X-10-81 "},{"reference":"Willard HF, Ambani LM, Hart AC, Mahoney MJ, Rosenberg LE. 1976. Rapid prenatal and postnatal detection of inborn errors of propionate, methylmalonate, and cobalamin metabolism: A sensitive assay using cultured cells. Human Genetics 34: 277-283.
","pubmedId":"","doi":"10.1007/BF00295291 "}],"title":"Modeling Inherited Methylmalonic Acidemia Using Isogenic Human Induced Pluripotent Stem Cell-Derived Hepatocytes with Mutations in Methylmalonyl-CoA Mutase
","reviews":[],"curatorReviews":[]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"3f756953-970b-41a6-a004-3b135fd7f3b1","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}