Centrosomes promote the assembly of the mitotic spindle by nucleating microtubules from within the peri-centriolar material (PCM). At the end of mitosis, centrosomes disassemble and the PCM disperses. In the 1-cell C. elegans embryo, polarity cues result in distinct disassembly patterns of the anterior vs. posterior centrosome. Here, we show that fluorescent proteins attached to SPD-5, a major PCM protein commonly used as a centrosome marker, can alter the pattern of posterior centrosome disassembly. This highlights the ability of fluorescent proteins to interfere with cellular structures and processes, and provides a new tool to symmetrize centrosome disassembly.
","acknowledgements":"The authors would like to thank Mohammad Rahman, Kevin O’Connell, and Jason Pfister (NIDDK, NIH) for helpful discussions. We also thank Jessica Feldman (Stanford University), Alex Dammermann (University of Vienna), and Karen Oegema (UC San Diego) for worm strains.
","authors":[{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics",""],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft"],"email":"rob.mirabello@nih.gov","firstName":"Robert","lastName":"Mirabello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-8009-0016"},{"affiliations":["University of Oregon, Eugene, OR, United States","National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["Department of Biology","The Laboratory of Biochemistry and Genetics",""],"credit":["investigation","conceptualization","writing_reviewEditing"],"email":"aruddick@uoregon.edu","firstName":"Abigail","lastName":"Ruddick","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-4902-0631"},{"affiliations":["Ohio Wesleyan University, Delaware, OH, United States","University of Oregon, Eugene, OR, United States"],"departments":["Department of Biological Sciences","Department of Biology"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"drhamill@owu.edu","firstName":"Danielle","lastName":"Hamill","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3748-2643"},{"affiliations":["University of Oregon, Eugene, OR, United States"],"departments":["Department of Biology"],"credit":["conceptualization","supervision","writing_reviewEditing","fundingAcquisition"],"email":"bowerman@uoregon.edu","firstName":"Bruce","lastName":"Bowerman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-6479-8707"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"richa.maheshwari@nih.gov","firstName":"Richa","lastName":"Maheshwari","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9266-5736"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","fundingAcquisition","project","supervision","writing_originalDraft"],"email":"ornac@niddk.nih.gov","firstName":"Orna","lastName":"Cohen-Fix","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-5682-1287"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"R.S.M., A.R., R.M and O.C.F were supported by a National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) intramural grant to O.C-F. (DK069012-18). D.R.H. was supported by a postdoctoral fellowship from the American Cancer Society (PF-4444) and by NIH grant R01GM58017 to B.B. B.B. was also supported by NIH grant R35GM131749.
This research was supported, in part, by the Intramural Research Program of the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) within the National Institutes of Health (NIH). The contributions of the NIH authors were made as part of their official duties as NIH federal employees, are in compliance with agency policy requirements, and are considered Works of the United States Government. However, the findings and conclusions presented in this paper are those of the authors and do not necessarily reflect the views of the NIH or the U.S. Department of Health and Human Services. Open Access funding provided by National Institute of Diabetes and Digestive and Kidney Diseases.
","image":{"url":"https://portal.micropublication.org/uploads/24ad9d746657bb47346a74600b80fd72.jpg"},"imageCaption":"(A) Confocal fluorescent microscopy images of the indicated fluorescently tagged SPD-5 in 1-cell C. elegans embryos at metaphase and at 4 and 5 minutes after metaphase. The alleles indicated in white are untagged. Embryos are all oriented with anterior end facing left. The outline of the embryo in panel i is shown for orientation purposes. The strains in each panel are: i: JLF359, ii: OCF176, iii: OCF259, iv: OCF187, v: OCF218, vi and vii: OCF221, viii: OCF258.
(B) Indirect immunofluorescence of SPD-5 using anti-SPD-5 antibodies (in green) of three embryos in anaphase to telophase (from left to right), as described in Hamill et al (2002). DNA is stain by propidium iodide (red). Scale bar: 10 µm
(C) Length of posterior PCM at 4 minutes after metaphase, for strains with endogenous and/or transgenic tagged SPD-5, as indicated. N/A indicates that the strain did not contain a transgene. Centrosomes where the PCM was at least 5 µm long were considered flattened. n= number of embryos analyzed. **p=0.0015 for RFPend vs GFP1end; ***p=0.0003 for RFPend vs GFP2end; ns: p≥0.05. Statistical analysis was done using one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Error bars: mean ± SD.
(D) Linkers between the FP C-terminus and SPD-5 N-terminus in each of the discussed strains. (E) Area of posterior centrosomes at metaphase. n (from left to right) = 11, 9, 11, 9, 10, 10, and 8. ns: p≥0.05 as determined by one-way ANOVA Brown-Forsythe test with Dunnett's multiple comparisons correction. Error bars: mean ± SD.
(F) Brood size of indicated strains at 20°C. “none/none” denotes a control strain, OCF15, containing an mCherry::SP12 transgene present in every strain used in this paper except for the tagRFP-T strain. n (from left to right) = 9, 10, 10, 10, 20, 11, 9, and 11. ****p<0.0001 for RFPend vs GFP1end + untagged spd-5trans. ns: p≥0.05, as determined by one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Error bars: mean ± SD.
","imageTitle":"Tagging SPD-5 with fluorescent proteins can prevent posterior centrosome flattening in the 1-cell C. elegans embryo
","methods":"C. elegans Strains
The C. elegans strains used in this study were derived from the N2 strain (Bristol; Brenner, 1974) and its derivatives and are listed under Reagents. Strain OCF259 was created by crossing OCF15 with strain JLF361, described previously (Magescas et al., 2019). Strains were maintained at 20°C on E. coli OP50 lawns seeded on MYOB agarose using standard methods (Brenner, 1974).
CRISPR-Cas9
Tagging of spd-5 with sfGFP was mostly done according to previously published methods (Paix et al., 2017). The sfGFP sequence was inserted into a pUC-GW-Amp vector by Azenta Life Sciences. The sequence is as follows, with linkers in bold and introns in lowercase:
GGTGGTTCCGGTGGTTCTGGTGGTTCTGTCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGgtaagtttaaacatatatatactaactaaccctgattatttaaattttcagCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCgtaagtttaaacagttcggtactaactaaccatacatatttaaattttcagGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTgtaagtttaaacatgattttactaactaactaatctaatttaaattttcagAACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAGGTGGTTCCGGTGGTTCTGGTGGTTCT
Because ssDNA repair templates have been shown to be more efficient than dsDNA, we used repair template primers with phosphorothioate linkages introduced for the first 5 nucleotides on the 5' left homology arm, permitting digestion with T7 exonuclease to create a single-stranded repair template (Noteborn et al., 2020). The sequences of the primers were as follows:
Forward primer, with 120 bp spd-5 promoter (up to ATG) homology arm and 20 bp homology with sfGFP N-terminus, in bold. Asterisks indicate phosphorothioate bond:
T*G*C*T*G*AAGCTTCAAATTTTGCAACCTCCTGTTCATTTTGACTCAAAACTCTTAATCCCAAAAAAACGCTCAATTTTGTTTTCGAACCCGTTTCTTGTTTCAGAAAACTTCGCGTTAAATGGTCAGCAAAGGAGAAGAACT
Reverse primer, with 145 bp spd-5 coding sequence homology arm and 20 bp homology with sfGFP C-terminal linker, in bold:
CTGACAATACTTGCTGTTGAGTGGCACTGGTCGAAGACGTTCTTTTGTCTCCTTCAACATTCAGAACTGGTTGCGACATAGATCTTCGTGGCTGGCCCTCGACATGCTCGAGATTGGAGTCTTCATTAAGAACTGAGTTGTCTTCAGAACCACCAGAACCACCGG
Our gRNA sequence to target the spd-5 start codon was: GGATAATTCTGTGCTCAACG
Microscopy
Gravid adults were immobilized on a cover slip with 50 mM levamisole in standard M9 buffer and dissected with hypodermic needles to release their embryos. The cover slip was then transferred to a pad of 2% agarose in standard M9 buffer on a glass slide. Images were taken using a Nikon confocal Ti2 microscope with a Yokogawa CSU-X1 spinning disk and a Photometrics Prime 95B camera using a Nikon oil 60×1.40 NA Apo Plan objective. Images were captured using Nikon Elements software version 5.21.03. Centrosomes were imaged across a 20-µm slice at z=1 µm intervals (21 total images per stack) and at 1-minute intervals starting around metaphase until the approximate completion of centrosome disassembly. Indirect immunofluorescence were as described in Hamill et al, 2002.
Image Analysis
All images were analyzed using Fiji (Schindelin et al., 2012; https://imagej.net/ij/).
Measurements
To measure PCM length, a maximal projection was created using all 21 slices of each image. The timepoint at which metaphase occurs was determined by centrosome shape and positioning: mitotic spindle length (i.e. distance between centrosomes) is around 15 microns at metaphase (Greenan et al., 2010). Metaphase centrosomes are also circular and static; once anaphase begins, the PCM deforms and the centrosomes begin regression to the embryonic poles. At four minutes post-metaphase, the boundary of the posterior centrosome was traced by hand using Fiji's freehand selection tool. The mean and minimum values inside this hand-traced object were recorded, and the average of these two values was set as a minimum threshold to highlight the pixels of the centrosome. The length of the PCM was measured as the length of its longest axis.
For centrosome area, the same tracing and thresholding protocol was followed as PCM length. Area was determined rather than length (namely diameter) to avoid ambiguities in the placement of the line to measure diameter. Once thresholding had determined the pixels constituting the centrosome, this area was measured.
For brood size, single L4s were placed on OP50 E. coli lawns seeded on MYOB agarose in a small petri dish (35x10mm). OP50 E. coli lawns were ensured to be in the center of the petri dish to prevent worms from straying close to the outer walls. Each worm's progeny was counted by removing its hatched larvae from the dish until no new progeny were laid. Parents were often sequentially transferred to 1 or 2 plates to prevent plates from getting too crowded with progeny.
Statistical Analyses
All analyses were done using GraphPad Prism [Version 10.6.1 (799)]. D'Agostino-Pearson, Anderson-Darling, Shapiro-Wilk, and Kolmogorov-Smirnov tests were used to test for normality of distributions. Standard deviations (SDs) for all datasets were measured. When samples were normal and had variable SDs, Brown-Forsythe and Welch's ANOVA tests, with Dunnett's T3 multiple comparisons test with individual variances computed for each comparison, were used. When datasets were not normal (nonparametric), the Kruskal-Wallis test with Dunn's correction for multiple comparisons was used.
","reagents":"Reagents
Strain name | Referred to in this study | Genotype | Reference |
| RFPend | Magescas et al., 2019 | |
| N/A | unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Joseph-Strauss et al., 2012 |
| GFP1end | spd-5(vie26[GFP::spd-5::loxP]) I; his-72(erb77[his-72::linker::mTurquoise2]) III; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2023 |
| untagged spd-5end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + untagged spd-5trans | spd-5(vie26[GFP::spd-5::loxP]) I; ltSi1129[(pZZ2) spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; spd-5(vie26[GFP::spd-5::loxP]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| sfGFPend | spd-5(ocf110[sfGFP::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
| GFP2end | spd-5(wow52[GFP::3xflag::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
*Available from the Caenorhabditis Genetics Center
Notes on strains
1The tagRFP-T includes short insertions (S2_S2delinsVSKGE/H230_K231insKLNGMDELY) from EGFP's termini, as determined by sequencing. This is the predominant variant of tagRFP-T, according to FPbase (https://www.fpbase.org/protein/tagrfp-t/).
2The version of GFP present in all strains in this paper, as determined by sequencing, is original GFP from Aequorea victoria with two mutations: S65C—a common mutation in C. elegans GFP for improved photostability—and Q80R—a common “neutral” mutation (Tsien, 1998; Green et al., 2008).
3The GFP::SPD-5 allele in GFP3trans, ltSi1141, is frequently referred to in the literature as ltSi202, including in Woodruff et al., 2015. This allele originated in the Oegema lab, which reports the correct allele for this construct is ltSi1141 (KO, personal communication).
","patternDescription":"Abstract
Centrosomes promote the assembly of the mitotic spindle by nucleating microtubules from within the peri-centriolar material (PCM). At the end of mitosis, centrosomes disassemble and the PCM disperses. In the 1-cell C. elegans embryo, polarity cues result in distinct disassembly patterns of the anterior vs. posterior centrosome. Here, we show that fluorescent proteins attached to SPD-5, a major PCM protein commonly used as a centrosome marker, can alter the pattern of posterior centrosome disassembly. This highlights the ability of fluorescent proteins to interfere with cellular structures and processes, and provides a new tool to symmetrize centrosome disassembly.
Description
Centrosomes, composed of barrel-like centrioles surrounded by peri-centriolar material (PCM), are dynamic structures that help build mitotic spindles in metazoan cells by promoting microtubule nucleation (Nigg and Raff, 2009). Centrosomes increase in size until metaphase as the PCM expands, a process known as centrosome maturation. In C. elegans, SPD-5 is a coiled-coil protein that serves as a major PCM protein by acting as a scaffold (Hamill et al., 2002). SPD-5's phosphorylation by the kinase PLK-1 drives SPD-5 multimerization and recruitment of downstream clients, resulting in centrosome maturation (Wueseke et al., 2016; Woodruff et al., 2017; Cabral et al., 2019; Ohta et al., 2021; Nakajo et al., 2022; Rios et al., 2024; Ohta et al., 2026). At the end of mitosis, the PCM is dismantled in a process known as centrosome disassembly by the combined action of phosphatases and microtubule-mediated forces (Woodruff et al., 2014; Conduit et al., 2015; Enos et al., 2018). In C. elegans, dephosphorylation weakens SPD-5's intermolecular interactions, allowing microtubule-mediated forces to rip apart the PCM (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). In the 1-cell embryo, centrosome disassembly is asymmetric; in telophase, the anterior centrosome remains spherical while the posterior centrosome flattens due to microtubule-pulling forces (Strome and Wood, 1983; Keating and White, 1998; Hamill et al., 2002; Severson and Bowerman, 2003). Similar flattening is also observed in other organisms, such as the nematode Ascaris megalocephala (Boveri, 1900), the surf clam Spisula solidissima (Dan and Ito, 1984) and across multiple orders of sea urchins (Boveri, 1900; Dan, 1979; Endo, 1980; Paweletz et al., 1984).
In the C. elegans embryo, the centrosome is surrounded by a membrane reticulum called the centriculum (Maheshwari et al., 2023; Maheshwari et al., 2026). To follow the fate of the centriculum after metaphase, we visualized centrosomes by live fluorescent confocal microscopy using SPD-5 tagged with a fluorescence protein (FP). SPD-5 is commonly used for this purpose, and we had several such constructs on hand that have been previously used in the field (e.g. (Cabral et al., 2019; Magescas et al., 2019; Garbrecht et al., 2021; Magescas et al., 2021; Holzer et al., 2022; Garcia-Baucells et al., 2025)). Using endogenously expressed tagRFP-T::SPD-5 (allele: wow36 (Magescas et al., 2019), henceforth “RFPend”), we observed the expected flattening of the posterior but not anterior centrosome (Fig. 1Ai), similar to the centrosome flattening observed by indirect immunofluorescence [Fig. 1B and (Hamill et al., 2002; Severson and Bowerman, 2003; Enos et al., 2018)], and consistent with this this allele's behavior in previous publications (Magescas et al., 2019; Rios et al., 2024; Schreiner et al., 2025). Unexpectedly, in the two endogenous GFP::SPD-5 constructs (vie26 (Cabral et al., 2019) and wow52 (Magescas et al., 2019), referred to here as GFP1end and GFP2end, respectively), the flattening of the posterior centrosome was abolished (Figs. 1Aii and iii). To quantify this effect, we imaged embryos every minute starting at metaphase. Centrosome flattening began 4 minutes after metaphase and increased through 5 and 6 minutes. At 5 minutes, the PCM had begun disassembling into puncta that were occasionally too faint or disperse to measure. We thus quantified posterior centrosome flattening by measuring the length of the PCM long axis at 4 minutes after metaphase (Fig. 1C).
We classified any centrosome with a ≥ 5.0 µm PCM at 4 minutes post-metaphase as being flattened. In a strain expressing RFPend, posterior centrosomes flattened in 100% of embryos imaged (Figs. 1Ai, 1C). In contrast, posterior centrosomes failed to flatten in the two GFP::SPD-5 strains, GFP1end and GFP2end, and posterior PCM lengths in these strains were significantly shorter than posterior RFPend centrosomes (Figs. 1Aii, 1Aiii, and 1C). In addition to the fluorescent tag, RFPend, GFP1end and GFP2end differ in the linkers between the FP and SPD-5 (Fig. 1D). To determine whether these three constructs lead a general difference in PCM morphology, we measured centrosome areas at metaphase (when centrosomes are spherical) and found no significant differences between the three strains (Fig. 1E).
We also examined centrosome flattening in a strain expressing GFP::SPD-5 as a transgene, (ltSi1141 (Woodruff et al., 2015), termed GFP3trans), in the presence of untagged endogenous SPD-5. GFP3trans's linker sequence is much shorter than those in GFP1end and GFP2end (Fig. 1D) but the GFP itself is identical between all three strains. Interestingly, nearly all centrosomes in GFP3trans flattened (Fig. 1C). This is consistent with Enos et al., (2018) and Erpf et al., (2019) who observed posterior centrosome flattening in strains expressing the same construct. Given the presence of the untagged endogenous SPD-5 in GFP3trans, we hypothesized that either the untagged endogenous protein was rescuing flattening by diluting GFP3trans, or GFP3trans itself permitted centrosome flattening.
To test if untagged SPD-5 can rescue centrosome flattening in the presence of GFP::SPD-5, we combined GFP1end with untagged transgenic SPD-5. 100% of centrosomes flattened in this strain (Figs. 1Av and 1C), suggesting that untagged SPD-5 can rescue centrosome flattening that is inhibited by GFP::SPD-5 constructs used here. We next examined whether GFP3trans itself is permissive to centrosome flattening by combining it with GFP1end. We reasoned that if GFP3trans permits flattening in the presence of GFP1end, then GFP3trans behaves as an untagged SPD-5. Interestingly, in this GFP1end + GFP3trans strain, 44% of centrosomes flattened (Figs. 1Avi and vii, and 1C). GFP and other FPs can dimerize and perturb organelle morphology (Zacharias et al., 2002; Snapp et al., 2003; Costantini et al., 2012). In our case, the expression of GFP1end and GFP2end as the sole source of SPD-5 may have increased inter-GFP::SPD-5 interactions, thus preventing anaphase SPD-5 dispersal and consequently, centrosome flattening. The presence of untagged SPD-5 would increase the average distance between GFP1end or GFP2end molecules, reducing their ability to interact. GFP3trans has a much shorter linker than GFP1end or GFP2end; the short linker might constrain GFP3trans's dimerization, thus perturbing centrosome flattening to a lesser degree than GFP1end or GFP2end. Furthermore, in strains expressing both GFP3trans and GFP1end, posterior centrosome flattening might occur in embryos with higher relative levels of GFP3trans expression, while in embryos with higher relative GFP1end expression, flattening might be inhibited.
Thus far, the only strains that exhibited posterior centrosome flattening were RFPend and those expressing SPD-5 transgenes. We therefore sought to construct a strain expressing endogenously tagged “green” SPD-5 that exhibited wild type centrosome flattening. To this end, we used super-folder GFP (sfGFP), which has been shown to be more monomeric than GFP by gel filtration, crystallography, and cell-based assays (Zacharias et al., 2002; Pedelacq et al., 2006; Costantini et al., 2012). However, recent reports using cell-based assays reported sfGFP might dimerize, although less so than many other FPs, like tagRFP-T (Cranfill et al., 2016; Stoddard and Rolland, 2019; Fraikin et al., 2025). Using CRISPR-Cas9 gene editing, we tagged SPD-5 endogenously, affixing sfGFP to SPD-5's N-terminus via a 9 amino acid linker reminiscent of GFP3trans's linker (Fig. 1D). In this strain, where sfGFP::SPD-5 is the only source of SPD-5, 100% of posterior centrosomes flattened after metaphase (Figs. 1Aviii, 1C). Thus, we successfully constructed an endogenous green FP-tagged SPD-5 that retains normal centrosome morphology during late mitosis.
Whether FP dimerization is what led to a defect in centrosome flattening in the strains expressing GFP1end and GFP2end remains an open question. Beyond dimerization, FPs could disrupt PCM disassembly by interfering with microtubule nucleation or SPD-5's accessibility to phosphatases, as both microtubules and phosphatases are required for PCM disassembly (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). It also remains unknown whether inhibiting centrosome flattening leads to a developmental defect. We determined the brood sizes of all the strains in this study and found that only one strain, GFP1end + untagged spd-5trans, had significantly lower broods compared to RFPend (Fig. 1F), and even it was well within the range of brood sizes previously reported for wild-type N2 worms (Mertz et al., 2025). However, brood size is a crude measure for potential developmental defects that may be compensated for later, and the consequences of abolishing posterior centrosome flattening should be examined further. In this regard, the GFP1end and GFP2end alleles provide useful tools that inhibit centrosome flattening without global disruption of microtubules, phosphatases, or motor proteins. Our study further underscores that PCM disassembly is sensitive to the properties of its constituent proteins.
","references":[{"reference":"Boveri, T. (1900). Ueber die Natur der Centrosomen. In Zellen-Studien (Vol. 4). Gustav Fischer. https://www.biodiversitylibrary.org/page/6303288?__cf_chl_f_tk=isKyV5iYcAKbMmWILzBkaRICOd_nvnOpACnVfVr9Udg-1783435793-1.0.1.1-Yokbr3F40lKm8gaHKAmFpvi576TxyuvGHnB4piuVk4Q#page/7/mode/1up (Jena, Germany: G. Fischer)
","pubmedId":"","doi":""},{"reference":"Brenner S. 1974. THE GENETICS OF CAENORHABDITIS ELEGANS. Genetics 77: 71-94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Cabral G, Laos T, Dumont J, Dammermann A. 2019. Differential Requirements for Centrioles in Mitotic Centrosome Growth and Maintenance. Developmental Cell 50: 355-366.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2019.06.004"},{"reference":"Conduit PT, Wainman A, Raff JW. 2015. Centrosome function and assembly in animal cells. Nature Reviews Molecular Cell Biology 16: 611-624.
","pubmedId":"","doi":"10.1038/nrm4062"},{"reference":"Costantini LM, Fossati M, Francolini M, Snapp EL. 2012. Assessing the Tendency of Fluorescent Proteins to Oligomerize Under Physiologic Conditions. Traffic 13: 643-649.
","pubmedId":"","doi":"10.1111/j.1600-0854.2012.01336.x"},{"reference":"Cranfill PJ, Sell BR, Baird MA, Allen JR, Lavagnino Z, de Gruiter HM, et al., Piston. 2016. Quantitative assessment of fluorescent proteins. Nature Methods 13: 557-562.
","pubmedId":"","doi":"10.1038/nmeth.3891"},{"reference":"DAN K. 1979. STUDIES ON UNEQUAL CLEAVAGE IN SEA URCHINS I. MIGRATION OF THE NUCLEI TO THE VEGETAL POLE. Development, Growth and Differentiation 21: 527-535.
","pubmedId":"","doi":"10.1111/j.1440-169X.1979.00527.x"},{"reference":"DAN K, ITO S. 1984. Studies of Unequal Cleavage in Molluscs: I. Nuclear Behavior and Anchorage of a Spindle Pole to Cortex as Revealed by Isolation Technique. Development, Growth & Differentiation 26: 249-262.
","pubmedId":"","doi":"10.1111/j.1440-169X.1984.00249.x"},{"reference":"ENDO S. 1980. FURTHER OBSERVATIONS ON THE CLUSTERS OF GRANULAR MATERIAL AROUND THE CENTRIOLE IN THE SEA URCHIN EGG: CHANGES IN DISTRIBUTION DURING MITOSIS*. Development, Growth and Differentiation 22: 509-516.
","pubmedId":"","doi":"10.1111/j.1440-169X.1980.00509.x"},{"reference":"Erpf AC, Stenzel L, Memar N, Antoniolli M, Osepashvili M, Schnabel R, Conradt B, Mikeladze-Dvali T. 2019. PCMD-1 Organizes Centrosome Matrix Assembly in C. elegans. Current Biology 29: 1324-1336.e6.
","pubmedId":"","doi":"10.1016/j.cub.2019.03.029"},{"reference":"Fraikin N, Couturier A, Mercier R, Lesterlin C. 2025. A palette of bright and photostable monomeric fluorescent proteins for bacterial time-lapse imaging. Science Advances 11: 10.1126/sciadv.ads6201.
","pubmedId":"","doi":"10.1126/sciadv.ads6201"},{"reference":"Garbrecht J, Laos T, Holzer E, Dillinger M, Dammermann A. 2021. An acentriolar centrosome at the C. elegans ciliary base. Current Biology 31: 2418-2428.e8.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.023"},{"reference":"Garcia-Baucells Jl, Bevilacqua C, Rufin M, Rumpf-Kienzl C, Zampetaki A, Andriotis OG, et al., Dammermann. 2025. Centrosome Softening As A Mechanical Adaptation For Mitosis. : 10.1101/2025.09.09.675178.
","pubmedId":"","doi":"10.1101/2025.09.09.675178"},{"reference":"Green RA, Audhya A, Pozniakovsky A, Dammermann A, Pemble H, Monen J, et al., Oegema. 2008. Expression and Imaging of Fluorescent Proteins in the C. elegans Gonad and Early Embryo. Methods in Cell Biology,Fluorescent Proteins : 179-218.
","pubmedId":"","doi":"10.1016/S0091-679X(08)85009-1"},{"reference":"Greenan G, Brangwynne CP, Jaensch S, Gharakhani Jb, Jülicher F, Hyman AA. 2010. Centrosome Size Sets Mitotic Spindle Length in Caenorhabditis elegans Embryos. Current Biology 20: 353-358.
","pubmedId":"","doi":"10.1016/j.cub.2009.12.050"},{"reference":"Hamill DR, Severson AF, Carter JC, Bowerman B. 2002. Centrosome Maturation and Mitotic Spindle Assembly in C. elegans Require SPD-5, a Protein with Multiple Coiled-Coil Domains. Developmental Cell 3: 673-684.
","pubmedId":"","doi":"10.1016/s1534-5807(02)00327-1"},{"reference":"Holzer E, Rumpf-Kienzl C, Falk S, Dammermann A. 2022. A modified TurboID approach identifies tissue-specific centriolar components in C. elegans. PLOS Genetics 18: e1010150.
","pubmedId":"","doi":"10.1371/journal.pgen.1010150"},{"reference":"Joseph-Strauss D, Gorjánácz Mts, Santarella-Mellwig R, Voronina E, Audhya A, Cohen-Fix O. 2012. Sm protein down-regulation leads to defects in nuclear pore complex disassembly and distribution in C. elegans embryos. Developmental Biology 365: 445-457.
","pubmedId":"","doi":"10.1016/j.ydbio.2012.02.036"},{"reference":"Keating HH, White JG. 1998. Centrosome dynamics in early embryos of Caenorhabditis elegans. Journal of Cell Science 111: 3027-3033.
","pubmedId":"","doi":"10.1242/jcs.111.20.3027"},{"reference":"Magescas Jrm, Eskinazi S, Tran MV, Feldman JL. 2021. Centriole-less pericentriolar material serves as a microtubule organizing center at the base of C. elegans sensory cilia. Current Biology 31: 2410-2417.e6.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.022"},{"reference":"Magescas Jrm, Zonka JC, Feldman JL. 2019. A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome. eLife 8: 10.7554/elife.47867.
","pubmedId":"","doi":"10.7554/eLife.47867"},{"reference":"Maheshwari R, Rahman MM, Drey S, Onyundo M, Fabig G, Martinez MAQ, et al., Cohen-Fix. 2023. A membrane reticulum, the centriculum, affects centrosome size and function in Caenorhabditis elegans. Current Biology 33: 791-806.e7.
","pubmedId":"","doi":"10.1016/j.cub.2022.12.059"},{"reference":"Maheshwari R, Rahman MM, Ruddick A, Drey S, Mirabello RS, Cohen-Fix O. 2026. The centriculum, a membrane reticulum that surrounds\n Caenorhabditis elegans\n centrosomes, might serve as a microtubule filter. Journal of Cell Science 139: 10.1242/jcs.264404.
","pubmedId":"","doi":"10.1242/jcs.264404"},{"reference":"Mittasch Mu, Tran VM, Rios MU, Fritsch AW, Enos SJ, Ferreira Gomes B, et al., Woodruff. 2020. Regulated changes in material properties underlie centrosome disassembly during mitotic exit. Journal of Cell Biology 219: 10.1083/jcb.201912036.
","pubmedId":"","doi":"10.1083/jcb.201912036"},{"reference":"Nakajo M, Kano H, Tsuyama K, Haruta N, Sugimoto A. 2022. Centrosome maturation requires phosphorylation-mediated sequential domain interactions of SPD-5. Journal of Cell Science 135: 10.1242/jcs.259025.
","pubmedId":"","doi":"10.1242/jcs.259025"},{"reference":"Nigg EA, Raff JW. 2009. Centrioles, Centrosomes, and Cilia in Health and Disease. Cell 139: 663-678.
","pubmedId":"","doi":"10.1016/j.cell.2009.10.036"},{"reference":"Noteborn WEM, Abendstein L, Sharp TH. 2020. One-Pot Synthesis of Defined-Length ssDNA for Multiscaffold DNA Origami. Bioconjugate Chemistry 32: 94-98.
","pubmedId":"","doi":"10.1021/acs.bioconjchem.0c00644"},{"reference":"Ohta M, Arakawa O, Gu Y, Tian W, Corbett KD, Desai A, Oegema K. 2026. Phosphorylation remodels the mitotic centrosome matrix to generate bipartite γ-tubulin complex docking sites. Science Advances 12: 10.1126/sciadv.aed6539.
","pubmedId":"","doi":"10.1126/sciadv.aed6539"},{"reference":"Ohta M, Zhao Z, Wu D, Wang S, Harrison JL, Gómez-Cavazos JSn, Desai A, Oegema KF. 2021. Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosome. Journal of Cell Biology 220: 10.1083/jcb.202009083.
","pubmedId":"","doi":"10.1083/jcb.202009083"},{"reference":"Paix A, Folkmann A, Seydoux G. 2017. Precision genome editing using CRISPR-Cas9 and linear repair templates in C. elegans. Methods 121-122: 86-93.
","pubmedId":"","doi":"10.1016/j.ymeth.2017.03.023"},{"reference":"Paweletz N, Mazia D, Finze EM. 1984. The centrosome cycle in the mitotic cycle of sea urchin eggs. Experimental Cell Research 152: 47-65.
","pubmedId":"","doi":"10.1016/0014-4827(84)90229-5"},{"reference":"Pédelacq JD, Cabantous Sp, Tran T, Terwilliger TC, Waldo GS. 2005. Engineering and characterization of a superfolder green fluorescent protein. Nature Biotechnology 24: 79-88.
","pubmedId":"","doi":"10.1038/nbt1172"},{"reference":"Rios MU, Bagnucka MgA, Ryder BD, Ferreira Gomes B, Familiari NE, Yaguchi K, et al., Woodruff. 2024. Multivalent coiled-coil interactions enable full-scale centrosome assembly and strength. Journal of Cell Biology 223: 10.1083/jcb.202306142.
","pubmedId":"","doi":"10.1083/jcb.202306142"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Schreiner A, Heim A, Pletschacher L, Alznauer LM, Schwenkert S, Wolff F, Zanin E, Mikeladze-Dvali T. 2025. PCMD-1 stabilizes the PCM scaffold and facilitates centriole separation. Journal of Cell Biology 224: 10.1083/jcb.202411107.
","pubmedId":"","doi":"10.1083/jcb.202411107"},{"reference":"Severson AF, Bowerman B. 2003. Myosin and the PAR proteins polarize microfilament-dependent forces that shape and position mitotic spindles in Caenorhabditis elegans . The Journal of Cell Biology 161: 21-26.
","pubmedId":"","doi":"10.1083/jcb.200210171"},{"reference":"Snapp EL, Hegde RS, Francolini M, Lombardo F, Colombo S, Pedrazzini E, Borgese N, Lippincott-Schwartz J. 2003. Formation of stacked ER cisternae by low affinity protein interactions. The Journal of Cell Biology 163: 257-269.
","pubmedId":"","doi":"10.1083/jcb.200306020"},{"reference":"Stoddard A, Rolland V. 2019. I see the light! Fluorescent proteins suitable for cell wall/apoplast targeting in\n Nicotiana benthamiana\n leaves. Plant Direct 3: 10.1002/pld3.112.
","pubmedId":"","doi":"10.1002/pld3.112"},{"reference":"Strome S, Wood WB. 1983. Generation of asymmetry and segregation of germ-line granules in early C. elegans embryos. Cell 35: 15-25.
","pubmedId":"","doi":"10.1016/0092-8674(83)90203-9"},{"reference":"Tsien RY. 1998. THE GREEN FLUORESCENT PROTEIN. Annual Review of Biochemistry 67: 509-544.
","pubmedId":"","doi":"10.1146/annurev.biochem.67.1.509"},{"reference":"Woodruff JB, Ferreira Gomes B, Widlund PO, Mahamid J, Honigmann A, Hyman AA. 2017. The Centrosome Is a Selective Condensate that Nucleates Microtubules by Concentrating Tubulin. Cell 169: 1066-1077.e10.
","pubmedId":"","doi":"10.1016/j.cell.2017.05.028"},{"reference":"Woodruff JB, Wueseke O, Hyman AA. 2014. Pericentriolar material structure and dynamics. Philosophical Transactions of the Royal Society B: Biological Sciences 369: 20130459.
","pubmedId":"","doi":"10.1098/rstb.2013.0459"},{"reference":"Woodruff JB, Wueseke O, Viscardi V, Mahamid J, Ochoa SD, Bunkenborg J, et al., Hyman. 2015. Regulated assembly of a supramolecular centrosome scaffold in vitro. Science 348: 808-812.
","pubmedId":"","doi":"10.1126/science.aaa3923"},{"reference":"Wueseke O, Zwicker D, Schwager A, Wong YL, Oegema K, Jülicher F, Hyman AA, Woodruff JB. 2016. Polo-like kinase phosphorylation determines\n Caenorhabditis\n elegans\n centrosome size and density by biasing SPD-5 toward an assembly-competent conformation. Biology Open 5: 1431-1440.
","pubmedId":"","doi":"10.1242/bio.020990"},{"reference":"Zacharias DA, Violin JD, Newton AC, Tsien RY. 2002. Partitioning of Lipid-Modified Monomeric GFPs into Membrane Microdomains of Live Cells. Science 296: 913-916.
","pubmedId":"","doi":"10.1126/science.1068539%208539%20068539"}],"title":"Fluorescent Tags Attached to the Centrosome Protein SPD-5 Can Disrupt PCM Morphology During Centrosome Disassembly in the 1-cell C. elegans Embryo
","reviews":[{"reviewer":{"displayName":"Jeffrey Woodruff"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"afe1ba7b-e978-49aa-be20-981f396056ce","decision":"revise","abstract":"Centrosomes promote the assembly of the mitotic spindle by nucleating microtubules from within the peri-centriolar material (PCM). At the end of mitosis, centrosomes disassemble and the PCM disperses. In the 1-cell C. elegans embryo, polarity cues result in distinct disassembly patterns of the anterior vs. posterior centrosome. Here, we show that fluorescent proteins attached to SPD-5, a major PCM protein commonly used as a centrosome marker, can alter the pattern of posterior centrosome disassembly. This highlights the ability of fluorescent proteins to interfere with cellular structures and processes, and provides a new tool to symmetrize centrosome disassembly.
","acknowledgements":"The authors would like to thank Mohammad Rahman, Kevin O’Connell, and Jason Pfister (NIDDK, NIH) for helpful discussions. We also thank Jessica Feldman (Stanford University), Alex Dammermann (University of Vienna), and Karen Oegema (UC San Diego) for worm strains.
","authors":[{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics",""],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft"],"email":"rob.mirabello@nih.gov","firstName":"Robert","lastName":"Mirabello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-8009-0016"},{"affiliations":["University of Oregon, Eugene, OR, United States","National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["Department of Biology","The Laboratory of Biochemistry and Genetics",""],"credit":["investigation","conceptualization","writing_reviewEditing"],"email":"aruddick@uoregon.edu","firstName":"Abigail","lastName":"Ruddick","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-4902-0631"},{"affiliations":["Ohio Wesleyan University, Delaware, OH, United States","University of Oregon, Eugene, OR, United States"],"departments":["Department of Biological Sciences","Department of Biology"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"drhamill@owu.edu","firstName":"Danielle","lastName":"Hamill","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3748-2643"},{"affiliations":["University of Oregon, Eugene, OR, United States"],"departments":["Department of Biology"],"credit":["conceptualization","supervision","writing_reviewEditing","fundingAcquisition"],"email":"bowerman@uoregon.edu","firstName":"Bruce","lastName":"Bowerman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-6479-8707"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"richa.maheshwari@nih.gov","firstName":"Richa","lastName":"Maheshwari","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9266-5736"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","fundingAcquisition","project","supervision","writing_originalDraft"],"email":"ornac@niddk.nih.gov","firstName":"Orna","lastName":"Cohen-Fix","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-5682-1287"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"R.S.M., A.R., R.M and O.C.F were supported by a National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) intramural grant to O.C-F. (DK069012-18). D.R.H. was supported by a postdoctoral fellowship from the American Cancer Society (PF-4444) and by NIH grant R01GM58017 to B.B. B.B. was also supported by NIH grant R35GM131749.
This research was supported, in part, by the Intramural Research Program of the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) within the National Institutes of Health (NIH). The contributions of the NIH authors were made as part of their official duties as NIH federal employees, are in compliance with agency policy requirements, and are considered Works of the United States Government. However, the findings and conclusions presented in this paper are those of the authors and do not necessarily reflect the views of the NIH or the U.S. Department of Health and Human Services. Open Access funding provided by National Institute of Diabetes and Digestive and Kidney Diseases.
","image":{"url":"https://portal.micropublication.org/uploads/24ad9d746657bb47346a74600b80fd72.jpg"},"imageCaption":"(A) Confocal fluorescent microscopy images of the indicated fluorescently tagged SPD-5 in 1-cell C. elegans embryos at metaphase and at 4 and 5 minutes after metaphase. The alleles indicated in white are untagged. Embryos are all oriented with anterior end facing left. The outline of the embryo in panel i is shown for orientation purposes. The strains in each panel are: i: JLF359, ii: OCF176, iii: OCF259, iv: OCF187, v: OCF218, vi and vii: OCF221, viii: OCF258.
(B) Indirect immunofluorescence of SPD-5 using anti-SPD-5 antibodies (in green) of three embryos in anaphase to telophase (from left to right), as described in Hamill et al (2002). DNA is stain by propidium iodide (red). Scale bar: 10 µm
(C) Length of posterior PCM at 4 minutes after metaphase, for strains with endogenous and/or transgenic tagged SPD-5, as indicated. N/A indicates that the strain did not contain a transgene. Centrosomes where the PCM was at least 5 µm long were considered flattened. n= number of embryos analyzed. **p=0.0015 for RFPend vs GFP1end; ***p=0.0003 for RFPend vs GFP2end; ns: p≥0.05. Statistical analysis was done using one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Error bars: mean ± SD.
(D) Linkers between the FP C-terminus and SPD-5 N-terminus in each of the discussed strains. (E) Area of posterior centrosomes at metaphase. n (from left to right) = 11, 9, 11, 9, 10, 10, and 8. ns: p≥0.05 as determined by one-way ANOVA Brown-Forsythe test with Dunnett's multiple comparisons correction. Error bars: mean ± SD.
(F) Brood size of indicated strains at 20°C. “none/none” denotes a control strain, OCF15, containing an mCherry::SP12 transgene present in every strain used in this paper except for the tagRFP-T strain. n (from left to right) = 9, 10, 10, 10, 20, 11, 9, and 11. ****p<0.0001 for RFPend vs GFP1end + untagged spd-5trans. ns: p≥0.05, as determined by one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Error bars: mean ± SD.
","imageTitle":"Tagging SPD-5 with fluorescent proteins can prevent posterior centrosome flattening in the 1-cell C. elegans embryo
","methods":"C. elegans Strains
The C. elegans strains used in this study were derived from the N2 strain (Bristol; Brenner, 1974) and its derivatives and are listed under Reagents. Strain OCF259 was created by crossing OCF15 with strain JLF361, described previously (Magescas et al., 2019). Strains were maintained at 20°C on E. coli OP50 lawns seeded on MYOB agarose using standard methods (Brenner, 1974).
CRISPR-Cas9
Tagging of spd-5 with sfGFP was mostly done according to previously published methods (Paix et al., 2017). The sfGFP sequence was inserted into a pUC-GW-Amp vector by Azenta Life Sciences. The sequence is as follows, with linkers in bold and introns in lowercase:
GGTGGTTCCGGTGGTTCTGGTGGTTCTGTCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGgtaagtttaaacatatatatactaactaaccctgattatttaaattttcagCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCgtaagtttaaacagttcggtactaactaaccatacatatttaaattttcagGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTgtaagtttaaacatgattttactaactaactaatctaatttaaattttcagAACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAGGTGGTTCCGGTGGTTCTGGTGGTTCT
Because ssDNA repair templates have been shown to be more efficient than dsDNA, we used repair template primers with phosphorothioate linkages introduced for the first 5 nucleotides on the 5' left homology arm, permitting digestion with T7 exonuclease to create a single-stranded repair template (Noteborn et al., 2020). The sequences of the primers were as follows:
Forward primer, with 120 bp spd-5 promoter (up to ATG) homology arm and 20 bp homology with sfGFP N-terminus, in bold. Asterisks indicate phosphorothioate bond:
T*G*C*T*G*AAGCTTCAAATTTTGCAACCTCCTGTTCATTTTGACTCAAAACTCTTAATCCCAAAAAAACGCTCAATTTTGTTTTCGAACCCGTTTCTTGTTTCAGAAAACTTCGCGTTAAATGGTCAGCAAAGGAGAAGAACT
Reverse primer, with 145 bp spd-5 coding sequence homology arm and 20 bp homology with sfGFP C-terminal linker, in bold:
CTGACAATACTTGCTGTTGAGTGGCACTGGTCGAAGACGTTCTTTTGTCTCCTTCAACATTCAGAACTGGTTGCGACATAGATCTTCGTGGCTGGCCCTCGACATGCTCGAGATTGGAGTCTTCATTAAGAACTGAGTTGTCTTCAGAACCACCAGAACCACCGG
Our gRNA sequence to target the spd-5 start codon was: GGATAATTCTGTGCTCAACG
Microscopy
Gravid adults were immobilized on a cover slip with 50 mM levamisole in standard M9 buffer and dissected with hypodermic needles to release their embryos. The cover slip was then transferred to a pad of 2% agarose in standard M9 buffer on a glass slide. Images were taken using a Nikon confocal Ti2 microscope with a Yokogawa CSU-X1 spinning disk and a Photometrics Prime 95B camera using a Nikon oil 60×1.40 NA Apo Plan objective. Images were captured using Nikon Elements software version 5.21.03. Centrosomes were imaged across a 20-µm slice at z=1 µm intervals (21 total images per stack) and at 1-minute intervals starting around metaphase until the approximate completion of centrosome disassembly. Indirect immunofluorescence were as described in Hamill et al, 2002.
Image Analysis
All images were analyzed using Fiji (Schindelin et al., 2012; https://imagej.net/ij/).
Measurements
To measure PCM length, a maximal projection was created using all 21 slices of each image. The timepoint at which metaphase occurs was determined by centrosome shape and positioning: mitotic spindle length (i.e. distance between centrosomes) is around 15 microns at metaphase (Greenan et al., 2010). Metaphase centrosomes are also circular and static; once anaphase begins, the PCM deforms and the centrosomes begin regression to the embryonic poles. At four minutes post-metaphase, the boundary of the posterior centrosome was traced by hand using Fiji's freehand selection tool. The mean and minimum values inside this hand-traced object were recorded, and the average of these two values was set as a minimum threshold to highlight the pixels of the centrosome. The length of the PCM was measured as the length of its longest axis.
For centrosome area, the same tracing and thresholding protocol was followed as PCM length. Area was determined rather than length (namely diameter) to avoid ambiguities in the placement of the line to measure diameter. Once thresholding had determined the pixels constituting the centrosome, this area was measured.
For brood size, single L4s were placed on OP50 E. coli lawns seeded on MYOB agarose in a small petri dish (35x10mm). OP50 E. coli lawns were ensured to be in the center of the petri dish to prevent worms from straying close to the outer walls. Each worm's progeny was counted by removing its hatched larvae from the dish until no new progeny were laid. Parents were often sequentially transferred to 1 or 2 plates to prevent plates from getting too crowded with progeny.
Statistical Analyses
All analyses were done using GraphPad Prism [Version 10.6.1 (799)]. D'Agostino-Pearson, Anderson-Darling, Shapiro-Wilk, and Kolmogorov-Smirnov tests were used to test for normality of distributions. Standard deviations (SDs) for all datasets were measured. When samples were normal and had variable SDs, Brown-Forsythe and Welch's ANOVA tests, with Dunnett's T3 multiple comparisons test with individual variances computed for each comparison, were used. When datasets were not normal (nonparametric), the Kruskal-Wallis test with Dunn's correction for multiple comparisons was used.
","reagents":"Reagents
Strain name | Referred to in this study | Genotype | Reference |
| RFPend | Magescas et al., 2019 | |
| N/A | unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Joseph-Strauss et al., 2012 |
| GFP1end | spd-5(vie26[GFP::spd-5::loxP]) I; his-72(erb77[his-72::linker::mTurquoise2]) III; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2023 |
| untagged spd-5end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + untagged spd-5trans | spd-5(vie26[GFP::spd-5::loxP]) I; ltSi1129[(pZZ2) spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; spd-5(vie26[GFP::spd-5::loxP]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| sfGFPend | spd-5(ocf110[sfGFP::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
| GFP2end | spd-5(wow52[GFP::3xflag::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
*Available from the Caenorhabditis Genetics Center
Notes on strains
1The tagRFP-T includes short insertions (S2_S2delinsVSKGE/H230_K231insKLNGMDELY) from EGFP's termini, as determined by sequencing. This is the predominant variant of tagRFP-T, according to FPbase (https://www.fpbase.org/protein/tagrfp-t/).
2The version of GFP present in all strains in this paper, as determined by sequencing, is original GFP from Aequorea victoria with two mutations: S65C—a common mutation in C. elegans GFP for improved photostability—and Q80R—a common “neutral” mutation (Tsien, 1998; Green et al., 2008).
3The GFP::SPD-5 allele in GFP3trans, ltSi1141, is frequently referred to in the literature as ltSi202, including in Woodruff et al., 2015. This allele originated in the Oegema lab, which reports the correct allele for this construct is ltSi1141 (KO, personal communication).
","patternDescription":"Centrosomes, composed of barrel-like centrioles surrounded by peri-centriolar material (PCM), are dynamic structures that help build mitotic spindles in metazoan cells by promoting microtubule nucleation (Nigg and Raff, 2009). Centrosomes increase in size until metaphase as the PCM expands, a process known as centrosome maturation. In C. elegans, SPD-5 is a coiled-coil protein that serves as a major PCM protein by acting as a scaffold (Hamill et al., 2002). SPD-5's phosphorylation by the kinase PLK-1 drives SPD-5 multimerization and recruitment of downstream clients, resulting in centrosome maturation (Wueseke et al., 2016; Woodruff et al., 2017; Cabral et al., 2019; Ohta et al., 2021; Nakajo et al., 2022; Rios et al., 2024; Ohta et al., 2026). At the end of mitosis, the PCM is dismantled in a process known as centrosome disassembly by the combined action of phosphatases and microtubule-mediated forces (Woodruff et al., 2014; Conduit et al., 2015; Enos et al., 2018). In C. elegans, dephosphorylation weakens SPD-5's intermolecular interactions, allowing microtubule-mediated forces to rip apart the PCM (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). In the 1-cell embryo, centrosome disassembly is asymmetric; in telophase, the anterior centrosome remains spherical while the posterior centrosome flattens due to microtubule-pulling forces (Strome and Wood, 1983; Keating and White, 1998; Hamill et al., 2002; Severson and Bowerman, 2003). Similar flattening is also observed in other organisms, such as the nematode Ascaris megalocephala (Boveri, 1900), the surf clam Spisula solidissima (Dan and Ito, 1984) and across multiple orders of sea urchins (Boveri, 1900; Dan, 1979; Endo, 1980; Paweletz et al., 1984).
In the C. elegans embryo, the centrosome is surrounded by a membrane reticulum called the centriculum (Maheshwari et al., 2023; Maheshwari et al., 2026). To follow the fate of the centriculum after metaphase, we visualized centrosomes by live fluorescent confocal microscopy using SPD-5 tagged with a fluorescence protein (FP). SPD-5 is commonly used for this purpose, and we had several such constructs on hand that have been previously used in the field (e.g. (Cabral et al., 2019; Magescas et al., 2019; Garbrecht et al., 2021; Magescas et al., 2021; Holzer et al., 2022; Garcia-Baucells et al., 2025)). Using endogenously expressed tagRFP-T::SPD-5 (allele: wow36 (Magescas et al., 2019), henceforth “RFPend”), we observed the expected flattening of the posterior but not anterior centrosome (Fig. 1Ai), similar to the centrosome flattening observed by indirect immunofluorescence [Fig. 1B and (Hamill et al., 2002; Severson and Bowerman, 2003; Enos et al., 2018)], and consistent with this this allele's behavior in previous publications (Magescas et al., 2019; Rios et al., 2024; Schreiner et al., 2025). Unexpectedly, in the two endogenous GFP::SPD-5 constructs (vie26 (Cabral et al., 2019) and wow52 (Magescas et al., 2019), referred to here as GFP1end and GFP2end, respectively), the flattening of the posterior centrosome was abolished (Figs. 1Aii and iii). To quantify this effect, we imaged embryos every minute starting at metaphase. Centrosome flattening began 4 minutes after metaphase and increased through 5 and 6 minutes. At 5 minutes, the PCM had begun disassembling into puncta that were occasionally too faint or disperse to measure. We thus quantified posterior centrosome flattening by measuring the length of the PCM long axis at 4 minutes after metaphase (Fig. 1C).
We classified any centrosome with a ≥ 5.0 µm PCM at 4 minutes post-metaphase as being flattened. In a strain expressing RFPend, posterior centrosomes flattened in 100% of embryos imaged (Figs. 1Ai, 1C). In contrast, posterior centrosomes failed to flatten in the two GFP::SPD-5 strains, GFP1end and GFP2end, and posterior PCM lengths in these strains were significantly shorter than posterior RFPend centrosomes (Figs. 1Aii, 1Aiii, and 1C). In addition to the fluorescent tag, RFPend, GFP1end and GFP2end differ in the linkers between the FP and SPD-5 (Fig. 1D). To determine whether these three constructs lead a general difference in PCM morphology, we measured centrosome areas at metaphase (when centrosomes are spherical) and found no significant differences between the three strains (Fig. 1E).
We also examined centrosome flattening in a strain expressing GFP::SPD-5 as a transgene, (ltSi1141 (Woodruff et al., 2015), termed GFP3trans), in the presence of untagged endogenous SPD-5. GFP3trans's linker sequence is much shorter than those in GFP1end and GFP2end (Fig. 1D) but the GFP itself is identical between all three strains. Interestingly, nearly all centrosomes in GFP3trans flattened (Fig. 1C). This is consistent with Enos et al., (2018) and Erpf et al., (2019) who observed posterior centrosome flattening in strains expressing the same construct. Given the presence of the untagged endogenous SPD-5 in GFP3trans, we hypothesized that either the untagged endogenous protein was rescuing flattening by diluting GFP3trans, or GFP3trans itself permitted centrosome flattening.
To test if untagged SPD-5 can rescue centrosome flattening in the presence of GFP::SPD-5, we combined GFP1end with untagged transgenic SPD-5. 100% of centrosomes flattened in this strain (Figs. 1Av and 1C), suggesting that untagged SPD-5 can rescue centrosome flattening that is inhibited by GFP::SPD-5 constructs used here. We next examined whether GFP3trans itself is permissive to centrosome flattening by combining it with GFP1end. We reasoned that if GFP3trans permits flattening in the presence of GFP1end, then GFP3trans behaves as an untagged SPD-5. Interestingly, in this GFP1end + GFP3trans strain, 44% of centrosomes flattened (Figs. 1Avi and vii, and 1C). GFP and other FPs can dimerize and perturb organelle morphology (Zacharias et al., 2002; Snapp et al., 2003; Costantini et al., 2012). In our case, the expression of GFP1end and GFP2end as the sole source of SPD-5 may have increased inter-GFP::SPD-5 interactions, thus preventing anaphase SPD-5 dispersal and consequently, centrosome flattening. The presence of untagged SPD-5 would increase the average distance between GFP1end or GFP2end molecules, reducing their ability to interact. GFP3trans has a much shorter linker than GFP1end or GFP2end; the short linker might constrain GFP3trans's dimerization, thus perturbing centrosome flattening to a lesser degree than GFP1end or GFP2end. Furthermore, in strains expressing both GFP3trans and GFP1end, posterior centrosome flattening might occur in embryos with higher relative levels of GFP3trans expression, while in embryos with higher relative GFP1end expression, flattening might be inhibited.
Thus far, the only strains that exhibited posterior centrosome flattening were RFPend and those expressing SPD-5 transgenes. We therefore sought to construct a strain expressing endogenously tagged “green” SPD-5 that exhibited wild type centrosome flattening. To this end, we used super-folder GFP (sfGFP), which has been shown to be more monomeric than GFP by gel filtration, crystallography, and cell-based assays (Zacharias et al., 2002; Pedelacq et al., 2006; Costantini et al., 2012). However, recent reports using cell-based assays reported sfGFP might dimerize, although less so than many other FPs, like tagRFP-T (Cranfill et al., 2016; Stoddard and Rolland, 2019; Fraikin et al., 2025). Using CRISPR-Cas9 gene editing, we tagged SPD-5 endogenously, affixing sfGFP to SPD-5's N-terminus via a 9 amino acid linker reminiscent of GFP3trans's linker (Fig. 1D). In this strain, where sfGFP::SPD-5 is the only source of SPD-5, 100% of posterior centrosomes flattened after metaphase (Figs. 1Aviii, 1C). Thus, we successfully constructed an endogenous green FP-tagged SPD-5 that retains normal centrosome morphology during late mitosis.
Whether FP dimerization is what led to a defect in centrosome flattening in the strains expressing GFP1end and GFP2end remains an open question. Beyond dimerization, FPs could disrupt PCM disassembly by interfering with microtubule nucleation or SPD-5's accessibility to phosphatases, as both microtubules and phosphatases are required for PCM disassembly (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). It also remains unknown whether inhibiting centrosome flattening leads to a developmental defect. We determined the brood sizes of all the strains in this study and found that only one strain, GFP1end + untagged spd-5trans, had significantly lower broods compared to RFPend (Fig. 1F), and even it was well within the range of brood sizes previously reported for wild-type N2 worms (Mertz et al., 2025). However, brood size is a crude measure for potential developmental defects that may be compensated for later, and the consequences of abolishing posterior centrosome flattening should be examined further. In this regard, the GFP1end and GFP2end alleles provide useful tools that inhibit centrosome flattening without global disruption of microtubules, phosphatases, or motor proteins. Our study further underscores that PCM disassembly is sensitive to the properties of its constituent proteins.
","references":[{"reference":"Boveri, T. (1900). Ueber die Natur der Centrosomen. In Zellen-Studien (Vol. 4). Gustav Fischer. https://www.biodiversitylibrary.org/page/6303288?__cf_chl_f_tk=isKyV5iYcAKbMmWILzBkaRICOd_nvnOpACnVfVr9Udg-1783435793-1.0.1.1-Yokbr3F40lKm8gaHKAmFpvi576TxyuvGHnB4piuVk4Q#page/7/mode/1up (Jena, Germany: G. Fischer)
","pubmedId":"","doi":""},{"reference":"Brenner S. 1974. THE GENETICS OF CAENORHABDITIS ELEGANS. Genetics 77: 71-94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Cabral G, Laos T, Dumont J, Dammermann A. 2019. Differential Requirements for Centrioles in Mitotic Centrosome Growth and Maintenance. Developmental Cell 50: 355-366.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2019.06.004"},{"reference":"Conduit PT, Wainman A, Raff JW. 2015. Centrosome function and assembly in animal cells. Nature Reviews Molecular Cell Biology 16: 611-624.
","pubmedId":"","doi":"10.1038/nrm4062"},{"reference":"Costantini LM, Fossati M, Francolini M, Snapp EL. 2012. Assessing the Tendency of Fluorescent Proteins to Oligomerize Under Physiologic Conditions. Traffic 13: 643-649.
","pubmedId":"","doi":"10.1111/j.1600-0854.2012.01336.x"},{"reference":"Cranfill PJ, Sell BR, Baird MA, Allen JR, Lavagnino Z, de Gruiter HM, et al., Piston. 2016. Quantitative assessment of fluorescent proteins. Nature Methods 13: 557-562.
","pubmedId":"","doi":"10.1038/nmeth.3891"},{"reference":"DAN K. 1979. STUDIES ON UNEQUAL CLEAVAGE IN SEA URCHINS I. MIGRATION OF THE NUCLEI TO THE VEGETAL POLE. Development, Growth and Differentiation 21: 527-535.
","pubmedId":"","doi":"10.1111/j.1440-169X.1979.00527.x"},{"reference":"DAN K, ITO S. 1984. Studies of Unequal Cleavage in Molluscs: I. Nuclear Behavior and Anchorage of a Spindle Pole to Cortex as Revealed by Isolation Technique. Development, Growth & Differentiation 26: 249-262.
","pubmedId":"","doi":"10.1111/j.1440-169X.1984.00249.x"},{"reference":"ENDO S. 1980. FURTHER OBSERVATIONS ON THE CLUSTERS OF GRANULAR MATERIAL AROUND THE CENTRIOLE IN THE SEA URCHIN EGG: CHANGES IN DISTRIBUTION DURING MITOSIS*. Development, Growth and Differentiation 22: 509-516.
","pubmedId":"","doi":"10.1111/j.1440-169X.1980.00509.x"},{"reference":"Erpf AC, Stenzel L, Memar N, Antoniolli M, Osepashvili M, Schnabel R, Conradt B, Mikeladze-Dvali T. 2019. PCMD-1 Organizes Centrosome Matrix Assembly in C. elegans. Current Biology 29: 1324-1336.e6.
","pubmedId":"","doi":"10.1016/j.cub.2019.03.029"},{"reference":"Fraikin N, Couturier A, Mercier R, Lesterlin C. 2025. A palette of bright and photostable monomeric fluorescent proteins for bacterial time-lapse imaging. Science Advances 11: 10.1126/sciadv.ads6201.
","pubmedId":"","doi":"10.1126/sciadv.ads6201"},{"reference":"Garbrecht J, Laos T, Holzer E, Dillinger M, Dammermann A. 2021. An acentriolar centrosome at the C. elegans ciliary base. Current Biology 31: 2418-2428.e8.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.023"},{"reference":"Garcia-Baucells Jl, Bevilacqua C, Rufin M, Rumpf-Kienzl C, Zampetaki A, Andriotis OG, et al., Dammermann. 2025. Centrosome Softening As A Mechanical Adaptation For Mitosis. : 10.1101/2025.09.09.675178.
","pubmedId":"","doi":"10.1101/2025.09.09.675178"},{"reference":"Green RA, Audhya A, Pozniakovsky A, Dammermann A, Pemble H, Monen J, et al., Oegema. 2008. Expression and Imaging of Fluorescent Proteins in the C. elegans Gonad and Early Embryo. Methods in Cell Biology,Fluorescent Proteins : 179-218.
","pubmedId":"","doi":"10.1016/S0091-679X(08)85009-1"},{"reference":"Greenan G, Brangwynne CP, Jaensch S, Gharakhani Jb, Jülicher F, Hyman AA. 2010. Centrosome Size Sets Mitotic Spindle Length in Caenorhabditis elegans Embryos. Current Biology 20: 353-358.
","pubmedId":"","doi":"10.1016/j.cub.2009.12.050"},{"reference":"Hamill DR, Severson AF, Carter JC, Bowerman B. 2002. Centrosome Maturation and Mitotic Spindle Assembly in C. elegans Require SPD-5, a Protein with Multiple Coiled-Coil Domains. Developmental Cell 3: 673-684.
","pubmedId":"","doi":"10.1016/s1534-5807(02)00327-1"},{"reference":"Holzer E, Rumpf-Kienzl C, Falk S, Dammermann A. 2022. A modified TurboID approach identifies tissue-specific centriolar components in C. elegans. PLOS Genetics 18: e1010150.
","pubmedId":"","doi":"10.1371/journal.pgen.1010150"},{"reference":"Joseph-Strauss D, Gorjánácz Mts, Santarella-Mellwig R, Voronina E, Audhya A, Cohen-Fix O. 2012. Sm protein down-regulation leads to defects in nuclear pore complex disassembly and distribution in C. elegans embryos. Developmental Biology 365: 445-457.
","pubmedId":"","doi":"10.1016/j.ydbio.2012.02.036"},{"reference":"Keating HH, White JG. 1998. Centrosome dynamics in early embryos of Caenorhabditis elegans. Journal of Cell Science 111: 3027-3033.
","pubmedId":"","doi":"10.1242/jcs.111.20.3027"},{"reference":"Magescas Jrm, Eskinazi S, Tran MV, Feldman JL. 2021. Centriole-less pericentriolar material serves as a microtubule organizing center at the base of C. elegans sensory cilia. Current Biology 31: 2410-2417.e6.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.022"},{"reference":"Magescas Jrm, Zonka JC, Feldman JL. 2019. A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome. eLife 8: 10.7554/elife.47867.
","pubmedId":"","doi":"10.7554/eLife.47867"},{"reference":"Maheshwari R, Rahman MM, Drey S, Onyundo M, Fabig G, Martinez MAQ, et al., Cohen-Fix. 2023. A membrane reticulum, the centriculum, affects centrosome size and function in Caenorhabditis elegans. Current Biology 33: 791-806.e7.
","pubmedId":"","doi":"10.1016/j.cub.2022.12.059"},{"reference":"Maheshwari R, Rahman MM, Ruddick A, Drey S, Mirabello RS, Cohen-Fix O. 2026. The centriculum, a membrane reticulum that surrounds\n Caenorhabditis elegans\n centrosomes, might serve as a microtubule filter. Journal of Cell Science 139: 10.1242/jcs.264404.
","pubmedId":"","doi":"10.1242/jcs.264404"},{"reference":"Mittasch Mu, Tran VM, Rios MU, Fritsch AW, Enos SJ, Ferreira Gomes B, et al., Woodruff. 2020. Regulated changes in material properties underlie centrosome disassembly during mitotic exit. Journal of Cell Biology 219: 10.1083/jcb.201912036.
","pubmedId":"","doi":"10.1083/jcb.201912036"},{"reference":"Nakajo M, Kano H, Tsuyama K, Haruta N, Sugimoto A. 2022. Centrosome maturation requires phosphorylation-mediated sequential domain interactions of SPD-5. Journal of Cell Science 135: 10.1242/jcs.259025.
","pubmedId":"","doi":"10.1242/jcs.259025"},{"reference":"Nigg EA, Raff JW. 2009. Centrioles, Centrosomes, and Cilia in Health and Disease. Cell 139: 663-678.
","pubmedId":"","doi":"10.1016/j.cell.2009.10.036"},{"reference":"Noteborn WEM, Abendstein L, Sharp TH. 2020. One-Pot Synthesis of Defined-Length ssDNA for Multiscaffold DNA Origami. Bioconjugate Chemistry 32: 94-98.
","pubmedId":"","doi":"10.1021/acs.bioconjchem.0c00644"},{"reference":"Ohta M, Arakawa O, Gu Y, Tian W, Corbett KD, Desai A, Oegema K. 2026. Phosphorylation remodels the mitotic centrosome matrix to generate bipartite γ-tubulin complex docking sites. Science Advances 12: 10.1126/sciadv.aed6539.
","pubmedId":"","doi":"10.1126/sciadv.aed6539"},{"reference":"Ohta M, Zhao Z, Wu D, Wang S, Harrison JL, Gómez-Cavazos JSn, Desai A, Oegema KF. 2021. Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosome. Journal of Cell Biology 220: 10.1083/jcb.202009083.
","pubmedId":"","doi":"10.1083/jcb.202009083"},{"reference":"Paix A, Folkmann A, Seydoux G. 2017. Precision genome editing using CRISPR-Cas9 and linear repair templates in C. elegans. Methods 121-122: 86-93.
","pubmedId":"","doi":"10.1016/j.ymeth.2017.03.023"},{"reference":"Paweletz N, Mazia D, Finze EM. 1984. The centrosome cycle in the mitotic cycle of sea urchin eggs. Experimental Cell Research 152: 47-65.
","pubmedId":"","doi":"10.1016/0014-4827(84)90229-5"},{"reference":"Pédelacq JD, Cabantous Sp, Tran T, Terwilliger TC, Waldo GS. 2005. Engineering and characterization of a superfolder green fluorescent protein. Nature Biotechnology 24: 79-88.
","pubmedId":"","doi":"10.1038/nbt1172"},{"reference":"Rios MU, Bagnucka MgA, Ryder BD, Ferreira Gomes B, Familiari NE, Yaguchi K, et al., Woodruff. 2024. Multivalent coiled-coil interactions enable full-scale centrosome assembly and strength. Journal of Cell Biology 223: 10.1083/jcb.202306142.
","pubmedId":"","doi":"10.1083/jcb.202306142"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Schreiner A, Heim A, Pletschacher L, Alznauer LM, Schwenkert S, Wolff F, Zanin E, Mikeladze-Dvali T. 2025. PCMD-1 stabilizes the PCM scaffold and facilitates centriole separation. Journal of Cell Biology 224: 10.1083/jcb.202411107.
","pubmedId":"","doi":"10.1083/jcb.202411107"},{"reference":"Severson AF, Bowerman B. 2003. Myosin and the PAR proteins polarize microfilament-dependent forces that shape and position mitotic spindles in Caenorhabditis elegans . The Journal of Cell Biology 161: 21-26.
","pubmedId":"","doi":"10.1083/jcb.200210171"},{"reference":"Snapp EL, Hegde RS, Francolini M, Lombardo F, Colombo S, Pedrazzini E, Borgese N, Lippincott-Schwartz J. 2003. Formation of stacked ER cisternae by low affinity protein interactions. The Journal of Cell Biology 163: 257-269.
","pubmedId":"","doi":"10.1083/jcb.200306020"},{"reference":"Stoddard A, Rolland V. 2019. I see the light! Fluorescent proteins suitable for cell wall/apoplast targeting in\n Nicotiana benthamiana\n leaves. Plant Direct 3: 10.1002/pld3.112.
","pubmedId":"","doi":"10.1002/pld3.112"},{"reference":"Strome S, Wood WB. 1983. Generation of asymmetry and segregation of germ-line granules in early C. elegans embryos. Cell 35: 15-25.
","pubmedId":"","doi":"10.1016/0092-8674(83)90203-9"},{"reference":"Tsien RY. 1998. THE GREEN FLUORESCENT PROTEIN. Annual Review of Biochemistry 67: 509-544.
","pubmedId":"","doi":"10.1146/annurev.biochem.67.1.509"},{"reference":"Woodruff JB, Ferreira Gomes B, Widlund PO, Mahamid J, Honigmann A, Hyman AA. 2017. The Centrosome Is a Selective Condensate that Nucleates Microtubules by Concentrating Tubulin. Cell 169: 1066-1077.e10.
","pubmedId":"","doi":"10.1016/j.cell.2017.05.028"},{"reference":"Woodruff JB, Wueseke O, Hyman AA. 2014. Pericentriolar material structure and dynamics. Philosophical Transactions of the Royal Society B: Biological Sciences 369: 20130459.
","pubmedId":"","doi":"10.1098/rstb.2013.0459"},{"reference":"Woodruff JB, Wueseke O, Viscardi V, Mahamid J, Ochoa SD, Bunkenborg J, et al., Hyman. 2015. Regulated assembly of a supramolecular centrosome scaffold in vitro. Science 348: 808-812.
","pubmedId":"","doi":"10.1126/science.aaa3923"},{"reference":"Wueseke O, Zwicker D, Schwager A, Wong YL, Oegema K, Jülicher F, Hyman AA, Woodruff JB. 2016. Polo-like kinase phosphorylation determines\n Caenorhabditis\n elegans\n centrosome size and density by biasing SPD-5 toward an assembly-competent conformation. Biology Open 5: 1431-1440.
","pubmedId":"","doi":"10.1242/bio.020990"},{"reference":"Zacharias DA, Violin JD, Newton AC, Tsien RY. 2002. Partitioning of Lipid-Modified Monomeric GFPs into Membrane Microdomains of Live Cells. Science 296: 913-916.
","pubmedId":"","doi":"10.1126/science.1068539%208539%20068539"}],"title":"Fluorescent Tags Attached to the Centrosome Protein SPD-5 Can Disrupt PCM Morphology During Centrosome Disassembly in the 1-cell C. elegans Embryo
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"638714d1-633f-491e-8c4a-23bd099fe33c","decision":"accept","abstract":"Centrosomes promote mitotic spindle assembly by nucleating microtubules from the peri-centriolar material (PCM). At mitotic exit, centrosomes disassemble and the PCM disperses. In the 1-cell C. elegans embryo, polarity cues result in distinct disassembly patterns of the anterior vs. posterior centrosome. Here, we show that commonly used alleles of GFP-tagged SPD-5, a major PCM protein, can interfere with posterior centrosome flattening during disassembly. We also report the development of endogenous super-folder GFP::SPD-5 (sfGFP::SPD-5) that exhibits normal centrosome flattening. This highlights the ability of tags to interfere with cellular structures and processes, and provides a new tool to symmetrize centrosome disassembly.
","acknowledgements":"The authors would like to thank Kevin O’Connell and Jason Pfister (NIDDK, NIH) for helpful discussions. We also thank Jessica Feldman (Stanford University), Alex Dammermann (University of Vienna), and Karen Oegema (UC San Diego) for worm strains.
","authors":[{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics",""],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft"],"email":"rob.mirabello@nih.gov","firstName":"Robert","lastName":"Mirabello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-8009-0016"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["investigation","formalAnalysis","writing_reviewEditing"],"email":"mohammad.rahman@nih.gov","firstName":"Mohammad","lastName":"Rahman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-7355-0818"},{"affiliations":["University of Oregon, Eugene, OR, United States","National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["Department of Biology","The Laboratory of Biochemistry and Genetics",""],"credit":["investigation","conceptualization","writing_reviewEditing"],"email":"aruddick@uoregon.edu","firstName":"Abigail","lastName":"Ruddick","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-4902-0631"},{"affiliations":["Ohio Wesleyan University, Delaware, OH, United States","University of Oregon, Eugene, OR, United States"],"departments":["Department of Biological Sciences","Department of Biology"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"drhamill@owu.edu","firstName":"Danielle","lastName":"Hamill","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3748-2643"},{"affiliations":["University of Oregon, Eugene, OR, United States"],"departments":["Department of Biology"],"credit":["conceptualization","supervision","writing_reviewEditing","fundingAcquisition"],"email":"bowerman@uoregon.edu","firstName":"Bruce","lastName":"Bowerman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-6479-8707"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"richa.maheshwari@nih.gov","firstName":"Richa","lastName":"Maheshwari","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9266-5736"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","fundingAcquisition","project","supervision","writing_originalDraft"],"email":"ornac@niddk.nih.gov","firstName":"Orna","lastName":"Cohen-Fix","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-5682-1287"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"R.S.M., M.M.R., A.R., R.M and O.C.F were supported by a National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) intramural grant to O.C-F. (DK069012-18). D.R.H. was supported by a postdoctoral fellowship from the American Cancer Society (PF-4444) and by NIH grant R01GM58017 to B.B. B.B. was also supported by NIH grant R35GM131749.
This research was supported, in part, by the Intramural Research Program of the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) within the National Institutes of Health (NIH). The contributions of the NIH authors were made as part of their official duties as NIH federal employees, are in compliance with agency policy requirements, and are considered Works of the United States Government. However, the findings and conclusions presented in this paper are those of the authors and do not necessarily reflect the views of the NIH or the U.S. Department of Health and Human Services. Open Access funding provided by National Institute of Diabetes and Digestive and Kidney Diseases.
","image":{"url":"https://portal.micropublication.org/uploads/976b00c8c92203bedbffe3b8feb712d6.jpg"},"imageCaption":"(A) i-viii: Confocal fluorescent microscopy images of the indicated fluorescently tagged SPD-5 in 1-cell C. elegans embryos at metaphase and at 4 and 5 minutes after metaphase. The alleles indicated in white are untagged. Embryos are all oriented with anterior end facing left. The outline of the embryo in panel i is shown for orientation purposes. The strains in each panel are: i: JLF359, ii: OCF176, iii: OCF259, iv: OCF187, v: OCF218, vi and vii: OCF221, viii: OCF258. ix: A representative example of a time course of a posterior centrosome that exhibits flattening (JLF359; RFPend) from metaphase to the end of centrosome disassembly. Absolute fluorescence intensity range is the same across all panels. Scale bar: 3 µm. x: As in ix, but for a posterior centrosome that does not exhibit flattening (OCF176; GFP1end).
(B) Indirect immunofluorescence of SPD-5 using anti-SPD-5 antibodies (in green) of three embryos in anaphase to telophase (from top to bottom), as described in Hamill et al (2002). DNA is stained by propidium iodide (red). Scale bar: 10 µm
(C) Length of posterior PCM at 4 minutes after metaphase, for strains with endogenous and/or transgenic tagged SPD-5, as indicated. N/A indicates that the strain did not contain a transgene. Centrosomes where the PCM was at least 5 µm long were considered flattened. n= number of embryos analyzed. **p=0.0015 for RFPend vs GFP1end; ***p=0.0003 for RFPend vs GFP2end; ns: p≥0.05. Statistical analysis was done using one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Error bars: mean ± SD.
(D) Linker sequences between the FP C-terminus and SPD-5's N terminus, the linker's protein motifs (if present), and method of insertion into the genome for each of the spd-5 alleles shown in panel A.
(E) Area of posterior centrosomes at metaphase, brood size and embryonic viability for the strains described in panel A plus a control strain, OCF15 (last row), in which endogenous spd-5 is not tagged and there is no transgene. For metaphase centrosome area, n= 9-11. There were no statistically significant differences between any of the strains and the RFP strain as determined by one-way ANOVA Brown-Forsythe test with Dunnett's multiple comparisons correction (the control strain is untagged and thus could not be measured). Values represent mean ± SD. For brood size, n= 9-21 individual L4s. None of the strains were statistically different from the control, except the strain that only expressed a GFP::SPD-5 transgene (GFP3trans; OCF187), which showed a slightly higher brood size (p= 0.0116) as determined by one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Values represent mean ± SD. Embryonic viability was determined in triplicates. None of the strains were statistically different from the control. Values represent mean ± SD.
","imageTitle":"Tagging SPD-5 with fluorescent proteins can prevent posterior centrosome flattening in the 1-cell C. elegans embryo
","methods":"C. elegans Strains
The C. elegans strains used in this study were derived from the N2 strain (Bristol; Brenner, 1974) and its derivatives and are listed under Reagents. Strain OCF259 was created by crossing OCF15 with strain JLF361, described previously (Magescas et al., 2019). Strains were maintained at 20°C on E. coli OP50 lawns seeded on MYOB agarose using standard methods (Brenner, 1974).
CRISPR-Cas9
Tagging of spd-5 with sfGFP was mostly done according to previously published methods (Paix et al., 2017). The sfGFP sequence was inserted into a pUC-GW-Amp vector by Azenta Life Sciences. The sequence is as follows, with linkers in bold and introns in lowercase:
GGTGGTTCCGGTGGTTCTGGTGGTTCTGTCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGgtaagtttaaacatatatatactaactaaccctgattatttaaattttcagCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCgtaagtttaaacagttcggtactaactaaccatacatatttaaattttcagGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTgtaagtttaaacatgattttactaactaactaatctaatttaaattttcagAACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAGGTGGTTCCGGTGGTTCTGGTGGTTCT
Because ssDNA repair templates have been shown to be more efficient than dsDNA, we used repair template primers with phosphorothioate linkages introduced for the first 5 nucleotides on the 5' left homology arm, permitting digestion with T7 exonuclease to create a single-stranded repair template (Noteborn et al., 2020). The sequences of the primers were as follows:
Forward primer, with 120 bp spd-5 promoter (up to ATG) homology arm and 20 bp homology with sfGFP N-terminus, in bold. Asterisks indicate phosphorothioate bond:
T*G*C*T*G*AAGCTTCAAATTTTGCAACCTCCTGTTCATTTTGACTCAAAACTCTTAATCCCAAAAAAACGCTCAATTTTGTTTTCGAACCCGTTTCTTGTTTCAGAAAACTTCGCGTTAAATGGTCAGCAAAGGAGAAGAACT
Reverse primer, with 145 bp spd-5 coding sequence homology arm and 20 bp homology with sfGFP C-terminal linker, in bold:
CTGACAATACTTGCTGTTGAGTGGCACTGGTCGAAGACGTTCTTTTGTCTCCTTCAACATTCAGAACTGGTTGCGACATAGATCTTCGTGGCTGGCCCTCGACATGCTCGAGATTGGAGTCTTCATTAAGAACTGAGTTGTCTTCAGAACCACCAGAACCACCGG
Our gRNA sequence to target the spd-5 start codon was: GGATAATTCTGTGCTCAACG
Microscopy
Gravid adults were immobilized on a cover slip with 50 mM levamisole in standard M9 buffer and dissected with hypodermic needles to release their embryos. The cover slip was then transferred to a pad of 2% agarose in standard M9 buffer on a glass slide. Images were taken using a Nikon confocal Ti2 microscope with a Yokogawa CSU-X1 spinning disk and a Photometrics Prime 95B camera using a Nikon oil 60×1.40 NA Apo Plan objective. Images were captured using Nikon Elements software version 5.21.03. Centrosomes were imaged across a 20-µm slice at z=1 µm intervals (21 total images per stack) and at 1-minute intervals starting around metaphase until the approximate completion of centrosome disassembly. Indirect immunofluorescence was as described in Hamill et al, 2002.
Image Analysis
All images were analyzed using Fiji (Schindelin et al., 2012; https://imagej.net/ij/).
Measurements
To measure PCM length, a maximal projection was created using all 21 slices of each image. The timepoint at which metaphase occurs was determined by centrosome shape and positioning: mitotic spindle length (i.e. distance between centrosomes) is around 15 microns at metaphase (Greenan et al., 2010). Metaphase centrosomes are also circular and static; once anaphase begins, the PCM deforms and the centrosomes begin regression to the embryonic poles. At four minutes post-metaphase, the boundary of the posterior centrosome was traced by hand using Fiji's freehand selection tool. The mean and minimum values inside this hand-traced object were recorded, and the average of these two values was set as a minimum threshold to highlight the pixels of the centrosome. The length of the PCM was measured as the length of its longest axis.
For centrosome area, the same tracing and thresholding protocol was followed as PCM length. Area was determined rather than length (namely diameter) to avoid ambiguities in the placement of the line to measure diameter. Once thresholding had determined the pixels constituting the centrosome, this area was measured.
For brood size, single L4s were placed on OP50 E. coli lawns seeded on MYOB agarose in a small petri dish (35x10mm). OP50 E. coli lawns were ensured to be in the center of the petri dish to prevent worms from straying close to the outer walls. Each worm's progeny was counted by removing its hatched larvae from the dish until no new progeny were laid. Parents were often sequentially transferred to 1 or 2 plates to prevent plates from getting too crowded with progeny.
For embryonic viability, three MYOB plates with OP50 were inoculated with 10 gravid adults each (collected the day before as L4 larvae) and incubated at 20°C. Worms were allowed to lay eggs for 2 hours after which they were removed. The percent of eggs that hatched was first determined after 30 additional hours at 20°C, and the plates were inspected again 24 hours later.
Statistical Analyses
All analyses were done using GraphPad Prism [Version 10.6.1 (799)]. D'Agostino-Pearson, Anderson-Darling, Shapiro-Wilk, and Kolmogorov-Smirnov tests were used to test for normality of distributions. Standard deviations (SDs) for all datasets were measured. When samples were normal and had variable SDs, Brown-Forsythe and Welch's ANOVA tests, with Dunnett's T3 multiple comparisons test with individual variances computed for each comparison, were used. When datasets were not normal (nonparametric), the Kruskal-Wallis test with Dunn's correction for multiple comparisons was used.
","reagents":"Reagents
Strain name | Referred to in this study | Genotype | Reference |
| RFPend | Magescas et al., 2019 | |
| N/A | unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Joseph-Strauss et al., 2012 |
| GFP1end | spd-5(vie26[GFP::spd-5::loxP]) I; his-72(erb77[his-72::linker::mTurquoise2]) III; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2023 |
| untagged spd-5end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + untagged spd-5trans | spd-5(vie26[GFP::spd-5::loxP]) I; ltSi1129[(pZZ2) spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; spd-5(vie26[GFP::spd-5::loxP]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| sfGFPend | spd-5(ocf110[sfGFP::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
| GFP2end | spd-5(wow52[GFP::3xflag::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
*Available from the Caenorhabditis Genetics Center
Notes on strains
1The tagRFP-T includes short insertions (S2_S2delinsVSKGE/H230_K231insKLNGMDELY) from EGFP's termini, as determined by sequencing. This is the predominant variant of tagRFP-T, according to FPbase (https://www.fpbase.org/protein/tagrfp-t/).
2The version of GFP present in all strains in this paper, as determined by sequencing, is original GFP from Aequorea victoria with two mutations: S65C—a common mutation in C. elegans GFP for improved photostability—and Q80R—a common “neutral” mutation (Tsien, 1998; Green et al., 2008).
3The GFP::SPD-5 allele in GFP3trans, ltSi1141, is frequently referred to in the literature as ltSi202, including in Woodruff et al., 2015. This allele originated in the Oegema lab, which reports the correct allele for this construct is ltSi1141 (KO, personal communication).
","patternDescription":"Centrosomes, composed of barrel-like centrioles surrounded by peri-centriolar material (PCM), are dynamic structures that help build mitotic spindles in metazoan cells by promoting microtubule nucleation (Nigg and Raff, 2009). Centrosomes increase in size until metaphase as the PCM expands, a process known as centrosome maturation. In C. elegans, SPD-5 is a coiled-coil protein that serves as a major PCM protein by acting as a scaffold (Hamill et al., 2002). SPD-5's phosphorylation by the kinase PLK-1 drives SPD-5 multimerization and recruitment of downstream clients, resulting in centrosome maturation (Wueseke et al., 2016; Woodruff et al., 2017; Cabral et al., 2019; Ohta et al., 2021; Nakajo et al., 2022; Rios et al., 2024; Ohta et al., 2026). At the end of mitosis, the PCM is dismantled in a process known as centrosome disassembly by the combined action of phosphatases and microtubule-mediated forces (Woodruff et al., 2014; Conduit et al., 2015; Enos et al., 2018). In C. elegans, dephosphorylation weakens SPD-5's intermolecular interactions, allowing microtubule-mediated forces to rip apart the PCM (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). In the 1-cell embryo, centrosome disassembly is asymmetric; in telophase, the anterior centrosome remains spherical while the posterior centrosome flattens due to microtubule-pulling forces (Strome and Wood, 1983; Keating and White, 1998; Hamill et al., 2002; Severson and Bowerman, 2003). Similar flattening is also observed in other organisms, such as the nematode Ascaris megalocephala (Boveri, 1900), the surf clam Spisula solidissima (Dan and Ito, 1984) and across multiple orders of sea urchins (Boveri, 1900; Dan, 1979; Endo, 1980; Paweletz et al., 1984). The role of centrosome flattening is not known.
In the C. elegans embryo, the centrosome is surrounded by a membrane reticulum called the centriculum (Maheshwari et al., 2023; Maheshwari et al., 2026). To follow the fate of the centriculum after metaphase, we visualized centrosomes by live fluorescent confocal microscopy using SPD-5 tagged with a fluorescence protein (FP). SPD-5 is commonly used for this purpose, and we had several such constructs on hand that have been previously used in the field [e.g. (Cabral et al., 2019; Magescas et al., 2019; Garbrecht et al., 2021; Magescas et al., 2021; Holzer et al., 2022; Garcia-Baucells et al., 2025)]. Using endogenously expressed tagRFP-T::SPD-5 (allele: wow36 (Magescas et al., 2019), henceforth “RFPend”), we observed the expected flattening of the posterior but not anterior centrosome (Fig. 1Ai and ix), similar to the centrosome flattening observed by indirect immunofluorescence [Fig. 1B and (Hamill et al., 2002; Severson and Bowerman, 2003; Enos et al., 2018)], and consistent with this this allele's behavior in previous publications (Magescas et al., 2019; Rios et al., 2024; Schreiner et al., 2025). Unexpectedly, in strains expressing two different endogenously tagged GFP::SPD-5 constructs (vie26 (Cabral et al., 2019) and wow52 (Magescas et al., 2019), referred to here as GFP1end and GFP2end, respectively), the flattening of the posterior centrosome was abolished (Figs. 1Aii, iii and x). Despite the flattening defect, centrosomes in the GFP1end and GFP2end strains disassembled as in the RFP strain, as determined by the complete dispersal of SPD-5 fluorescence surrounding the centrioles (Figs 1Aix and x). To quantify the defect in flattening, embryos were imaged every minute starting at metaphase. Centrosome flattening began 4 minutes after metaphase and increased through 5 and 6 minutes. At 5 minutes, the PCM had begun disassembling into puncta that were occasionally too faint or disperse to measure. We thus quantified posterior centrosome flattening by measuring the length of the PCM long axis at 4 minutes after metaphase (Fig. 1C).
We classified any centrosome with a ≥ 5.0 µm PCM at 4 minutes post-metaphase as being flattened. In a strain expressing RFPend, posterior centrosomes flattened in 100% of embryos imaged (Figs. 1Ai, ix and 1C). In contrast, posterior centrosomes failed to flatten in the two GFP::SPD-5 strains, GFP1end and GFP2end, and posterior PCM lengths in these strains were significantly shorter than posterior RFPend centrosomes (Figs. 1Aii, iii, x, and 1C). In addition to the fluorescent tag, RFPend, GFP1end and GFP2end also differ in the linkers between the FP and SPD-5 (Fig. 1D). To determine whether these three constructs lead to a general difference in PCM morphology, we measured centrosome areas at metaphase (when centrosomes are spherical) and found no significant differences between the three strains (Fig. 1E).
We also examined centrosome flattening in a strain expressing GFP::SPD-5 as a transgene, (ltSi1141 (Woodruff et al., 2015), termed GFP3trans), in the presence of untagged endogenous SPD-5. GFP3trans's linker sequence is much shorter than those in GFP1end and GFP2end (Fig. 1D) but the GFP itself is identical between all three strains. Interestingly, nearly all centrosomes in GFP3trans flattened (Fig. 1C). This is consistent with Enos et al., (2018) and Erpf et al., (2019) who observed posterior centrosome flattening in strains expressing the same construct. Given the presence of the untagged endogenous SPD-5 in GFP3trans, we hypothesized that either the untagged endogenous protein was rescuing flattening by diluting GFP3trans, or GFP3trans itself permitted centrosome flattening.
To test if untagged SPD-5 can rescue centrosome flattening in the presence of GFP::SPD-5, we combined GFP1end with untagged transgenic SPD-5. 100% of centrosomes flattened in this strain (Figs. 1Av and 1C), suggesting that untagged SPD-5 can rescue centrosome flattening that is inhibited by the GFP::SPD-5 constructs used here. We next examined whether GFP3trans itself is permissive to centrosome flattening by combining it with GFP1end. We reasoned that if GFP3trans permits flattening in the presence of GFP1end, then GFP3trans behaves as an untagged SPD-5. Interestingly, in this GFP1end + GFP3trans strain, 44% of centrosomes flattened (Figs. 1Avi and vii, and 1C). GFP and other FPs can dimerize and perturb organelle morphology (Zacharias et al., 2002; Snapp et al., 2003; Costantini et al., 2012). In our case, the expression of GFP1end and GFP2end as the sole source of SPD-5 may have increased inter-GFP::SPD-5 interactions, thus preventing anaphase SPD-5 dispersal and consequently, centrosome flattening. The presence of untagged SPD-5 would increase the average distance between GFP1end or GFP2end molecules, reducing their ability to interact. GFP3trans has a much shorter linker than GFP1end or GFP2end (Fig. 1D); the short linker might constrain GFP3trans's dimerization, thus perturbing centrosome flattening to a lesser degree than GFP1end or GFP2end. Furthermore, in strains expressing both GFP3trans and GFP1end, posterior centrosome flattening might occur in embryos with higher relative levels of GFP3trans expression, while in embryos with higher relative GFP1end expression, flattening might be inhibited.
Thus far, the only strains that exhibited posterior centrosome flattening were RFPend and those expressing SPD-5 transgenes. We therefore sought to construct a strain expressing endogenously tagged “green” SPD-5 that exhibited wild type centrosome flattening without a transgene. To this end, we used super-folder GFP (sfGFP), which has been shown to be more monomeric than GFP by gel filtration, crystallography, and cell-based assays (Zacharias et al., 2002; Pedelacq et al., 2006; Costantini et al., 2012). Of note, recent reports using cell-based assays reported that sfGFP might dimerize, although less so than many other FPs, like tagRFP-T (Cranfill et al., 2016; Stoddard and Rolland, 2019; Fraikin et al., 2025). Using CRISPR-Cas9 gene editing, we tagged SPD-5 endogenously, affixing sfGFP to SPD-5's N-terminus via a 9 amino acid linker reminiscent of GFP3trans's linker (Fig. 1D). In this strain, where sfGFP::SPD-5 is the only source of SPD-5, 100% of posterior centrosomes flattened after metaphase (Figs. 1Aviii and 1C). Thus, we successfully constructed an endogenous green FP-tagged SPD-5 that retains normal centrosome morphology during late mitosis.
Whether FP dimerization is what led to a defect in centrosome flattening in the strains expressing GFP1end and GFP2end remains an open question. Beyond dimerization, FPs could disrupt PCM disassembly by interfering with microtubule nucleation or SPD-5's accessibility to phosphatases, as both microtubules and phosphatases are required for PCM disassembly (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). The nature of the linker (Fig. 1D) could have also affected the properties of the FP::SPD-5 fusion proteins. It also remains unknown whether inhibiting centrosome flattening leads to a developmental defect; neither brood size nor embryonic viability was significantly different in strains without posterior centrosome flattening compared to a control expressing untagged SPD-5 (Fig. 1E). Either flattening, or lack thereof, has no functional importance, or the embryo has robust mechanisms to compensate for this defect. Thus, the consequences of abolishing posterior centrosome flattening should be examined further. In this regard, if these SPD-5 fusion proteins do affect centrosome-related processes, there is a concern that they may exhibit synthetic genetic interactions under conditions that partially compromise centrosome function, even if these conditions, on their own, do not exhibit a centrosome defect. Finally, the GFP1end and GFP2end alleles provide useful tools that inhibit centrosome flattening without global disruption of microtubules, phosphatases, or motor proteins. Our study further underscores that PCM disassembly is sensitive to the properties of its constituent proteins.
","references":[{"reference":"Boveri, T. (1900). Ueber die Natur der Centrosomen. In Zellen-Studien (Vol. 4). Gustav Fischer. https://www.biodiversitylibrary.org/page/6303288?__cf_chl_f_tk=isKyV5iYcAKbMmWILzBkaRICOd_nvnOpACnVfVr9Udg-1783435793-1.0.1.1-Yokbr3F40lKm8gaHKAmFpvi576TxyuvGHnB4piuVk4Q#page/7/mode/1up (Jena, Germany: G. Fischer)
","pubmedId":"","doi":""},{"reference":"Brenner S. 1974. THE GENETICS OF CAENORHABDITIS ELEGANS. Genetics 77: 71-94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Cabral G, Laos T, Dumont J, Dammermann A. 2019. Differential Requirements for Centrioles in Mitotic Centrosome Growth and Maintenance. Developmental Cell 50: 355-366.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2019.06.004"},{"reference":"Conduit PT, Wainman A, Raff JW. 2015. Centrosome function and assembly in animal cells. Nature Reviews Molecular Cell Biology 16: 611-624.
","pubmedId":"","doi":"10.1038/nrm4062"},{"reference":"Costantini LM, Fossati M, Francolini M, Snapp EL. 2012. Assessing the Tendency of Fluorescent Proteins to Oligomerize Under Physiologic Conditions. Traffic 13: 643-649.
","pubmedId":"","doi":"10.1111/j.1600-0854.2012.01336.x"},{"reference":"Cranfill PJ, Sell BR, Baird MA, Allen JR, Lavagnino Z, de Gruiter HM, et al., Piston. 2016. Quantitative assessment of fluorescent proteins. Nature Methods 13: 557-562.
","pubmedId":"","doi":"10.1038/nmeth.3891"},{"reference":"DAN K. 1979. STUDIES ON UNEQUAL CLEAVAGE IN SEA URCHINS I. MIGRATION OF THE NUCLEI TO THE VEGETAL POLE. Development, Growth and Differentiation 21: 527-535.
","pubmedId":"","doi":"10.1111/j.1440-169X.1979.00527.x"},{"reference":"DAN K, ITO S. 1984. Studies of Unequal Cleavage in Molluscs: I. Nuclear Behavior and Anchorage of a Spindle Pole to Cortex as Revealed by Isolation Technique. Development, Growth & Differentiation 26: 249-262.
","pubmedId":"","doi":"10.1111/j.1440-169X.1984.00249.x"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics 200: 1035-1049.
","pubmedId":"","doi":"10.1534/genetics.115.178335"},{"reference":"Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. 2013. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nature Methods 10: 1028-1034.
","pubmedId":"","doi":"10.1038/nmeth.2641"},{"reference":"ENDO S. 1980. FURTHER OBSERVATIONS ON THE CLUSTERS OF GRANULAR MATERIAL AROUND THE CENTRIOLE IN THE SEA URCHIN EGG: CHANGES IN DISTRIBUTION DURING MITOSIS*. Development, Growth and Differentiation 22: 509-516.
","pubmedId":"","doi":"10.1111/j.1440-169X.1980.00509.x"},{"reference":"Enos SJ, Dressler M, Gomes BF, Hyman AA, Woodruff JB. 2017. Phosphatase PP2A and microtubule-mediated pulling forces disassemble centrosomes during mitotic exit. Biology Open : 10.1242/bio.029777.
","pubmedId":"","doi":"10.1242/bio.029777"},{"reference":"Erpf AC, Stenzel L, Memar N, Antoniolli M, Osepashvili M, Schnabel R, Conradt B, Mikeladze-Dvali T. 2019. PCMD-1 Organizes Centrosome Matrix Assembly in C. elegans. Current Biology 29: 1324-1336.e6.
","pubmedId":"","doi":"10.1016/j.cub.2019.03.029"},{"reference":"Fraikin N, Couturier A, Mercier R, Lesterlin C. 2025. A palette of bright and photostable monomeric fluorescent proteins for bacterial time-lapse imaging. Science Advances 11: 10.1126/sciadv.ads6201.
","pubmedId":"","doi":"10.1126/sciadv.ads6201"},{"reference":"Frøkjær-Jensen C, Wayne Davis M, Hopkins CE, Newman BJ, Thummel JM, Olesen SrP, Grunnet M, Jorgensen EM. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics 40: 1375-1383.
","pubmedId":"","doi":"10.1038/ng.248"},{"reference":"Garbrecht J, Laos T, Holzer E, Dillinger M, Dammermann A. 2021. An acentriolar centrosome at the C. elegans ciliary base. Current Biology 31: 2418-2428.e8.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.023"},{"reference":"Garcia-Baucells Jl, Bevilacqua C, Rufin M, Rumpf-Kienzl C, Zampetaki A, Andriotis OG, et al., Dammermann. 2025. Centrosome Softening As A Mechanical Adaptation For Mitosis. : 10.1101/2025.09.09.675178.
","pubmedId":"","doi":"10.1101/2025.09.09.675178"},{"reference":"Green RA, Audhya A, Pozniakovsky A, Dammermann A, Pemble H, Monen J, et al., Oegema. 2008. Expression and Imaging of Fluorescent Proteins in the C. elegans Gonad and Early Embryo. Methods in Cell Biology,Fluorescent Proteins : 179-218.
","pubmedId":"","doi":"10.1016/S0091-679X(08)85009-1"},{"reference":"Greenan G, Brangwynne CP, Jaensch S, Gharakhani Jb, Jülicher F, Hyman AA. 2010. Centrosome Size Sets Mitotic Spindle Length in Caenorhabditis elegans Embryos. Current Biology 20: 353-358.
","pubmedId":"","doi":"10.1016/j.cub.2009.12.050"},{"reference":"Hamill DR, Severson AF, Carter JC, Bowerman B. 2002. Centrosome Maturation and Mitotic Spindle Assembly in C. elegans Require SPD-5, a Protein with Multiple Coiled-Coil Domains. Developmental Cell 3: 673-684.
","pubmedId":"","doi":"10.1016/s1534-5807(02)00327-1"},{"reference":"Holzer E, Rumpf-Kienzl C, Falk S, Dammermann A. 2022. A modified TurboID approach identifies tissue-specific centriolar components in C. elegans. PLOS Genetics 18: e1010150.
","pubmedId":"","doi":"10.1371/journal.pgen.1010150"},{"reference":"Joseph-Strauss D, Gorjánácz Mts, Santarella-Mellwig R, Voronina E, Audhya A, Cohen-Fix O. 2012. Sm protein down-regulation leads to defects in nuclear pore complex disassembly and distribution in C. elegans embryos. Developmental Biology 365: 445-457.
","pubmedId":"","doi":"10.1016/j.ydbio.2012.02.036"},{"reference":"Keating HH, White JG. 1998. Centrosome dynamics in early embryos of Caenorhabditis elegans. Journal of Cell Science 111: 3027-3033.
","pubmedId":"","doi":"10.1242/jcs.111.20.3027"},{"reference":"Magescas Jrm, Eskinazi S, Tran MV, Feldman JL. 2021. Centriole-less pericentriolar material serves as a microtubule organizing center at the base of C. elegans sensory cilia. Current Biology 31: 2410-2417.e6.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.022"},{"reference":"Magescas Jrm, Zonka JC, Feldman JL. 2019. A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome. eLife 8: 10.7554/elife.47867.
","pubmedId":"","doi":"10.7554/eLife.47867"},{"reference":"Maheshwari R, Rahman MM, Drey S, Onyundo M, Fabig G, Martinez MAQ, et al., Cohen-Fix. 2023. A membrane reticulum, the centriculum, affects centrosome size and function in Caenorhabditis elegans. Current Biology 33: 791-806.e7.
","pubmedId":"","doi":"10.1016/j.cub.2022.12.059"},{"reference":"Maheshwari R, Rahman MM, Ruddick A, Drey S, Mirabello RS, Cohen-Fix O. 2026. The centriculum, a membrane reticulum that surrounds\n Caenorhabditis elegans\n centrosomes, might serve as a microtubule filter. Journal of Cell Science 139: 10.1242/jcs.264404.
","pubmedId":"","doi":"10.1242/jcs.264404"},{"reference":"Mittasch Mu, Tran VM, Rios MU, Fritsch AW, Enos SJ, Ferreira Gomes B, et al., Woodruff. 2020. Regulated changes in material properties underlie centrosome disassembly during mitotic exit. Journal of Cell Biology 219: 10.1083/jcb.201912036.
","pubmedId":"","doi":"10.1083/jcb.201912036"},{"reference":"Nakajo M, Kano H, Tsuyama K, Haruta N, Sugimoto A. 2022. Centrosome maturation requires phosphorylation-mediated sequential domain interactions of SPD-5. Journal of Cell Science 135: 10.1242/jcs.259025.
","pubmedId":"","doi":"10.1242/jcs.259025"},{"reference":"Nigg EA, Raff JW. 2009. Centrioles, Centrosomes, and Cilia in Health and Disease. Cell 139: 663-678.
","pubmedId":"","doi":"10.1016/j.cell.2009.10.036"},{"reference":"Noteborn WEM, Abendstein L, Sharp TH. 2020. One-Pot Synthesis of Defined-Length ssDNA for Multiscaffold DNA Origami. Bioconjugate Chemistry 32: 94-98.
","pubmedId":"","doi":"10.1021/acs.bioconjchem.0c00644"},{"reference":"Ohta M, Arakawa O, Gu Y, Tian W, Corbett KD, Desai A, Oegema K. 2026. Phosphorylation remodels the mitotic centrosome matrix to generate bipartite γ-tubulin complex docking sites. Science Advances 12: 10.1126/sciadv.aed6539.
","pubmedId":"","doi":"10.1126/sciadv.aed6539"},{"reference":"Ohta M, Zhao Z, Wu D, Wang S, Harrison JL, Gómez-Cavazos JSn, Desai A, Oegema KF. 2021. Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosome. Journal of Cell Biology 220: 10.1083/jcb.202009083.
","pubmedId":"","doi":"10.1083/jcb.202009083"},{"reference":"Paix A, Folkmann A, Seydoux G. 2017. Precision genome editing using CRISPR-Cas9 and linear repair templates in C. elegans. Methods 121-122: 86-93.
","pubmedId":"","doi":"10.1016/j.ymeth.2017.03.023"},{"reference":"Paweletz N, Mazia D, Finze EM. 1984. The centrosome cycle in the mitotic cycle of sea urchin eggs. Experimental Cell Research 152: 47-65.
","pubmedId":"","doi":"10.1016/0014-4827(84)90229-5"},{"reference":"Pédelacq JD, Cabantous Sp, Tran T, Terwilliger TC, Waldo GS. 2005. Engineering and characterization of a superfolder green fluorescent protein. Nature Biotechnology 24: 79-88.
","pubmedId":"","doi":"10.1038/nbt1172"},{"reference":"Rios MU, Bagnucka MgA, Ryder BD, Ferreira Gomes B, Familiari NE, Yaguchi K, et al., Woodruff. 2024. Multivalent coiled-coil interactions enable full-scale centrosome assembly and strength. Journal of Cell Biology 223: 10.1083/jcb.202306142.
","pubmedId":"","doi":"10.1083/jcb.202306142"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Schreiner A, Heim A, Pletschacher L, Alznauer LM, Schwenkert S, Wolff F, Zanin E, Mikeladze-Dvali T. 2025. PCMD-1 stabilizes the PCM scaffold and facilitates centriole separation. Journal of Cell Biology 224: 10.1083/jcb.202411107.
","pubmedId":"","doi":"10.1083/jcb.202411107"},{"reference":"Severson AF, Bowerman B. 2003. Myosin and the PAR proteins polarize microfilament-dependent forces that shape and position mitotic spindles in Caenorhabditis elegans . The Journal of Cell Biology 161: 21-26.
","pubmedId":"","doi":"10.1083/jcb.200210171"},{"reference":"Snapp EL, Hegde RS, Francolini M, Lombardo F, Colombo S, Pedrazzini E, Borgese N, Lippincott-Schwartz J. 2003. Formation of stacked ER cisternae by low affinity protein interactions. The Journal of Cell Biology 163: 257-269.
","pubmedId":"","doi":"10.1083/jcb.200306020"},{"reference":"Stoddard A, Rolland V. 2019. I see the light! Fluorescent proteins suitable for cell wall/apoplast targeting in\n Nicotiana benthamiana\n leaves. Plant Direct 3: 10.1002/pld3.112.
","pubmedId":"","doi":"10.1002/pld3.112"},{"reference":"Strome S, Wood WB. 1983. Generation of asymmetry and segregation of germ-line granules in early C. elegans embryos. Cell 35: 15-25.
","pubmedId":"","doi":"10.1016/0092-8674(83)90203-9"},{"reference":"Tsien RY. 1998. THE GREEN FLUORESCENT PROTEIN. Annual Review of Biochemistry 67: 509-544.
","pubmedId":"","doi":"10.1146/annurev.biochem.67.1.509"},{"reference":"Woodruff JB, Ferreira Gomes B, Widlund PO, Mahamid J, Honigmann A, Hyman AA. 2017. The Centrosome Is a Selective Condensate that Nucleates Microtubules by Concentrating Tubulin. Cell 169: 1066-1077.e10.
","pubmedId":"","doi":"10.1016/j.cell.2017.05.028"},{"reference":"Woodruff JB, Wueseke O, Hyman AA. 2014. Pericentriolar material structure and dynamics. Philosophical Transactions of the Royal Society B: Biological Sciences 369: 20130459.
","pubmedId":"","doi":"10.1098/rstb.2013.0459"},{"reference":"Woodruff JB, Wueseke O, Viscardi V, Mahamid J, Ochoa SD, Bunkenborg J, et al., Hyman. 2015. Regulated assembly of a supramolecular centrosome scaffold in vitro. Science 348: 808-812.
","pubmedId":"","doi":"10.1126/science.aaa3923"},{"reference":"Wueseke O, Zwicker D, Schwager A, Wong YL, Oegema K, Jülicher F, Hyman AA, Woodruff JB. 2016. Polo-like kinase phosphorylation determines\n Caenorhabditis\n elegans\n centrosome size and density by biasing SPD-5 toward an assembly-competent conformation. Biology Open 5: 1431-1440.
","pubmedId":"","doi":"10.1242/bio.020990"},{"reference":"Zacharias DA, Violin JD, Newton AC, Tsien RY. 2002. Partitioning of Lipid-Modified Monomeric GFPs into Membrane Microdomains of Live Cells. Science 296: 913-916.
","pubmedId":"","doi":"10.1126/science.1068539%208539%20068539"}],"title":"Tags Attached to the Centrosomal Protein SPD-5 Can Disrupt Centrosome Flattening During Anaphase of the 1-cell C. elegans Embryo
","reviews":[{"reviewer":{"displayName":"Jeffrey Woodruff"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1789867922029"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null}]},{"id":"1e1ec327-cdcf-4ad8-8f2c-1457e5503825","decision":"publish","abstract":"Centrosomes promote mitotic spindle assembly by nucleating microtubules from the peri-centriolar material (PCM). At mitotic exit, centrosomes disassemble and the PCM disperses. In the 1-cell C. elegans embryo, polarity cues result in distinct disassembly patterns of the anterior vs. posterior centrosome. Here, we show that commonly used alleles of GFP-tagged SPD-5, a major PCM protein, can interfere with posterior centrosome flattening during disassembly. We also report the development of endogenous super-folder GFP::SPD-5 (sfGFP::SPD-5) that exhibits normal centrosome flattening. This highlights the ability of tags to interfere with cellular structures and processes, and provides a new tool to symmetrize centrosome disassembly.
","acknowledgements":"The authors would like to thank Kevin O’Connell and Jason Pfister (NIDDK, NIH) for helpful discussions. We also thank Jessica Feldman (Stanford University), Alex Dammermann (University of Vienna), and Karen Oegema (UC San Diego) for worm strains.
","authors":[{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics",""],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft"],"email":"rob.mirabello@nih.gov","firstName":"Robert S.","lastName":"Mirabello","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0007-8009-0016"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["investigation","formalAnalysis","writing_reviewEditing"],"email":"mohammad.rahman@nih.gov","firstName":"Mohammad M.","lastName":"Rahman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-7355-0818"},{"affiliations":["University of Oregon, Eugene, OR, United States","National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["Department of Biology","The Laboratory of Biochemistry and Genetics",""],"credit":["investigation","conceptualization","writing_reviewEditing"],"email":"aruddick@uoregon.edu","firstName":"Abigail","lastName":"Ruddick","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0009-0008-4902-0631"},{"affiliations":["Ohio Wesleyan University, Delaware, OH, United States","University of Oregon, Eugene, OR, United States"],"departments":["Department of Biological Sciences","Department of Biology"],"credit":["conceptualization","investigation","writing_reviewEditing"],"email":"drhamill@owu.edu","firstName":"Danielle R.","lastName":"Hamill","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-3748-2643"},{"affiliations":["University of Oregon, Eugene, OR, United States"],"departments":["Department of Biology"],"credit":["conceptualization","supervision","writing_reviewEditing","fundingAcquisition"],"email":"bowerman@uoregon.edu","firstName":"Bruce","lastName":"Bowerman","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0002-6479-8707"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","supervision","writing_reviewEditing"],"email":"richa.maheshwari@nih.gov","firstName":"Richa","lastName":"Maheshwari","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9266-5736"},{"affiliations":["National Institute of Diabetes and Digestive and Kidney Diseases, Bethesda, MD, United States"],"departments":["The Laboratory of Biochemistry and Genetics"],"credit":["conceptualization","fundingAcquisition","project","supervision","writing_originalDraft"],"email":"ornac@niddk.nih.gov","firstName":"Orna","lastName":"Cohen-Fix","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-5682-1287"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"R.S.M., M.M.R., A.R., R.M and O.C.F were supported by a National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) intramural grant to O.C-F. (DK069012-18). D.R.H. was supported by a postdoctoral fellowship from the American Cancer Society (PF-4444) and by NIH grant R01GM58017 to B.B. B.B. was also supported by NIH grant R35GM131749.
This research was supported, in part, by the Intramural Research Program of the National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) within the National Institutes of Health (NIH). The contributions of the NIH authors were made as part of their official duties as NIH federal employees, are in compliance with agency policy requirements, and are considered Works of the United States Government. However, the findings and conclusions presented in this paper are those of the authors and do not necessarily reflect the views of the NIH or the U.S. Department of Health and Human Services. Open Access funding provided by National Institute of Diabetes and Digestive and Kidney Diseases.
","image":{"url":"https://portal.micropublication.org/uploads/976b00c8c92203bedbffe3b8feb712d6.jpg"},"imageCaption":"(A) i-viii: Confocal fluorescent microscopy images of the indicated fluorescently tagged SPD-5 in 1-cell C. elegans embryos at metaphase and at 4 and 5 minutes after metaphase. The alleles indicated in white are untagged. Embryos are all oriented with anterior end facing left. The outline of the embryo in panel i is shown for orientation purposes. The strains in each panel are: i: JLF359, ii: OCF176, iii: OCF259, iv: OCF187, v: OCF218, vi and vii: OCF221, viii: OCF258. ix: A representative example of a time course of a posterior centrosome that exhibits flattening (JLF359; RFPend) from metaphase to the end of centrosome disassembly. Absolute fluorescence intensity range is the same across all panels. Scale bar: 3 µm. x: As in ix, but for a posterior centrosome that does not exhibit flattening (OCF176; GFP1end).
(B) Indirect immunofluorescence of SPD-5 using anti-SPD-5 antibodies (in green) of three embryos in anaphase to telophase (from top to bottom), as described in Hamill et al (2002). DNA is stained by propidium iodide (red). Scale bar: 10 µm
(C) Length of posterior PCM at 4 minutes after metaphase, for strains with endogenous and/or transgenic tagged SPD-5, as indicated. N/A indicates that the strain did not contain a transgene. Centrosomes where the PCM was at least 5 µm long were considered flattened. n= number of embryos analyzed. **p=0.0015 for RFPend vs GFP1end; ***p=0.0003 for RFPend vs GFP2end; ns: p≥0.05. Statistical analysis was done using one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Error bars: mean ± SD.
(D) Linker sequences between the FP C-terminus and SPD-5's N terminus, the linker's protein motifs (if present), and method of insertion into the genome for each of the spd-5 alleles shown in panel A.
(E) Area of posterior centrosomes at metaphase, brood size and embryonic viability for the strains described in panel A plus a control strain, OCF15 (last row), in which endogenous spd-5 is not tagged and there is no transgene. For metaphase centrosome area, n= 9-11. There were no statistically significant differences between any of the strains and the RFP strain as determined by one-way ANOVA Brown-Forsythe test with Dunnett's multiple comparisons correction (the control strain is untagged and thus could not be measured). Values represent mean ± SD. For brood size, n= 9-21 individual L4s. None of the strains were statistically different from the control, except the strain that only expressed a GFP::SPD-5 transgene (GFP3trans; OCF187), which showed a slightly higher brood size (p= 0.0116) as determined by one-way ANOVA Kruskal-Wallis test with Dunn's multiple comparisons correction. Values represent mean ± SD. Embryonic viability was determined in triplicates. None of the strains were statistically different from the control. Values represent mean ± SD.
","imageTitle":"Tagging SPD-5 with fluorescent proteins can prevent posterior centrosome flattening in the 1-cell C. elegans embryo
","methods":"C. elegans Strains
The C. elegans strains used in this study were derived from the N2 strain (Bristol; Brenner, 1974) and its derivatives and are listed under Reagents. Strain OCF259 was created by crossing OCF15 with strain JLF361, described previously (Magescas et al., 2019). Strains were maintained at 20°C on E. coli OP50 lawns seeded on MYOB agarose using standard methods (Brenner, 1974).
CRISPR-Cas9
Tagging of spd-5 with sfGFP was mostly done according to previously published methods (Paix et al., 2017). The sfGFP sequence was inserted into a pUC-GW-Amp vector by Azenta Life Sciences. The sequence is as follows, with linkers in bold and introns in lowercase:
GGTGGTTCCGGTGGTTCTGGTGGTTCTGTCAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCCGTGGAGAGGGTGAAGGTGATGCTACAAACGGAAAACTCACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGgtaagtttaaacatatatatactaactaaccctgattatttaaattttcagCCAACACTTGTCACTACTCTGACCTATGGTGTTCAATGCTTTTCCCGTTATCCGGATCACATGAAACGGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAACGCACTATATCTTTCAAAGATGACGGGACCTACAAGACGCgtaagtttaaacagttcggtactaactaaccatacatatttaaattttcagGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATCGTATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTCGGACACAAACTCGAGTACAACTTTAACTCACACAATGTATACATCACGGCAGACAAACAAAAGAATGGAATCAAAGCTgtaagtttaaacatgattttactaactaactaatctaatttaaattttcagAACTTCAAAATTCGCCACAACGTTGAAGATGGTTCCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCGACACAATCTGTCCTTTCGAAAGATCCCAACGAAAAGCGTGACCACATGGTCCTTCTTGAGTTTGTAACTGCTGCTGGGATTACACATGGCATGGATGAGCTCTACAAAGGTGGTTCCGGTGGTTCTGGTGGTTCT
Because ssDNA repair templates have been shown to be more efficient than dsDNA, we used repair template primers with phosphorothioate linkages introduced for the first 5 nucleotides on the 5' left homology arm, permitting digestion with T7 exonuclease to create a single-stranded repair template (Noteborn et al., 2020). The sequences of the primers were as follows:
Forward primer, with 120 bp spd-5 promoter (up to ATG) homology arm and 20 bp homology with sfGFP N-terminus, in bold. Asterisks indicate phosphorothioate bond:
T*G*C*T*G*AAGCTTCAAATTTTGCAACCTCCTGTTCATTTTGACTCAAAACTCTTAATCCCAAAAAAACGCTCAATTTTGTTTTCGAACCCGTTTCTTGTTTCAGAAAACTTCGCGTTAAATGGTCAGCAAAGGAGAAGAACT
Reverse primer, with 145 bp spd-5 coding sequence homology arm and 20 bp homology with sfGFP C-terminal linker, in bold:
CTGACAATACTTGCTGTTGAGTGGCACTGGTCGAAGACGTTCTTTTGTCTCCTTCAACATTCAGAACTGGTTGCGACATAGATCTTCGTGGCTGGCCCTCGACATGCTCGAGATTGGAGTCTTCATTAAGAACTGAGTTGTCTTCAGAACCACCAGAACCACCGG
Our gRNA sequence to target the spd-5 start codon was: GGATAATTCTGTGCTCAACG
Microscopy
Gravid adults were immobilized on a cover slip with 50 mM levamisole in standard M9 buffer and dissected with hypodermic needles to release their embryos. The cover slip was then transferred to a pad of 2% agarose in standard M9 buffer on a glass slide. Images were taken using a Nikon confocal Ti2 microscope with a Yokogawa CSU-X1 spinning disk and a Photometrics Prime 95B camera using a Nikon oil 60×1.40 NA Apo Plan objective. Images were captured using Nikon Elements software version 5.21.03. Centrosomes were imaged across a 20-µm slice at z=1 µm intervals (21 total images per stack) and at 1-minute intervals starting around metaphase until the approximate completion of centrosome disassembly. Indirect immunofluorescence was as described in Hamill et al, 2002.
Image Analysis
All images were analyzed using Fiji (Schindelin et al., 2012; https://imagej.net/ij/).
Measurements
To measure PCM length, a maximal projection was created using all 21 slices of each image. The timepoint at which metaphase occurs was determined by centrosome shape and positioning: mitotic spindle length (i.e. distance between centrosomes) is around 15 microns at metaphase (Greenan et al., 2010). Metaphase centrosomes are also circular and static; once anaphase begins, the PCM deforms and the centrosomes begin regression to the embryonic poles. At four minutes post-metaphase, the boundary of the posterior centrosome was traced by hand using Fiji's freehand selection tool. The mean and minimum values inside this hand-traced object were recorded, and the average of these two values was set as a minimum threshold to highlight the pixels of the centrosome. The length of the PCM was measured as the length of its longest axis.
For centrosome area, the same tracing and thresholding protocol was followed as PCM length. Area was determined rather than length (namely diameter) to avoid ambiguities in the placement of the line to measure diameter. Once thresholding had determined the pixels constituting the centrosome, this area was measured.
For brood size, single L4s were placed on OP50 E. coli lawns seeded on MYOB agarose in a small petri dish (35x10mm). OP50 E. coli lawns were ensured to be in the center of the petri dish to prevent worms from straying close to the outer walls. Each worm's progeny was counted by removing its hatched larvae from the dish until no new progeny were laid. Parents were often sequentially transferred to 1 or 2 plates to prevent plates from getting too crowded with progeny.
For embryonic viability, three MYOB plates with OP50 were inoculated with 10 gravid adults each (collected the day before as L4 larvae) and incubated at 20°C. Worms were allowed to lay eggs for 2 hours after which they were removed. The percent of eggs that hatched was first determined after 30 additional hours at 20°C, and the plates were inspected again 24 hours later.
Statistical Analyses
All analyses were done using GraphPad Prism [Version 10.6.1 (799)]. D'Agostino-Pearson, Anderson-Darling, Shapiro-Wilk, and Kolmogorov-Smirnov tests were used to test for normality of distributions. Standard deviations (SDs) for all datasets were measured. When samples were normal and had variable SDs, Brown-Forsythe and Welch's ANOVA tests, with Dunnett's T3 multiple comparisons test with individual variances computed for each comparison, were used. When datasets were not normal (nonparametric), the Kruskal-Wallis test with Dunn's correction for multiple comparisons was used.
","reagents":"Reagents
Strain name | Referred to in this study | Genotype | Reference |
| RFPend | Magescas et al., 2019 | |
| N/A | unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Joseph-Strauss et al., 2012 |
| GFP1end | spd-5(vie26[GFP::spd-5::loxP]) I; his-72(erb77[his-72::linker::mTurquoise2]) III; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2023 |
| untagged spd-5end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + untagged spd-5trans | spd-5(vie26[GFP::spd-5::loxP]) I; ltSi1129[(pZZ2) spd-2p::spd-5(re-encoded) + Cbr-unc-119(+)] II; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| GFP1end + GFP3trans | ltSi1141[(pOD1021/pVV103) spd-2p::GFP::spd-5(re-encoded) + Cbr-unc-119(+)] II; spd-5(vie26[GFP::spd-5::loxP]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | Maheshwari et al., 2026 |
| sfGFPend | spd-5(ocf110[sfGFP::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
| GFP2end | spd-5(wow52[GFP::3xflag::spd-5]) I; unc-119(ed3) III; ocfIs2[pie-1p::mCherry::SP12::pie-1 3'UTR + unc-119(+)] | This study |
*Available from the Caenorhabditis Genetics Center
Notes on strains
1The tagRFP-T includes short insertions (S2_S2delinsVSKGE/H230_K231insKLNGMDELY) from EGFP's termini, as determined by sequencing. This is the predominant variant of tagRFP-T, according to FPbase (https://www.fpbase.org/protein/tagrfp-t/).
2The version of GFP present in all strains in this paper, as determined by sequencing, is original GFP from Aequorea victoria with two mutations: S65C—a common mutation in C. elegans GFP for improved photostability—and Q80R—a common “neutral” mutation (Tsien, 1998; Green et al., 2008).
3The GFP::SPD-5 allele in GFP3trans, ltSi1141, is frequently referred to in the literature as ltSi202, including in Woodruff et al., 2015. This allele originated in the Oegema lab, which reports the correct allele for this construct is ltSi1141 (KO, personal communication).
","patternDescription":"Centrosomes, composed of barrel-like centrioles surrounded by peri-centriolar material (PCM), are dynamic structures that help build mitotic spindles in metazoan cells by promoting microtubule nucleation (Nigg and Raff, 2009). Centrosomes increase in size until metaphase as the PCM expands, a process known as centrosome maturation. In C. elegans, SPD-5 is a coiled-coil protein that serves as a major PCM protein by acting as a scaffold (Hamill et al., 2002). SPD-5's phosphorylation by the kinase PLK-1 drives SPD-5 multimerization and recruitment of downstream clients, resulting in centrosome maturation (Wueseke et al., 2016; Woodruff et al., 2017; Cabral et al., 2019; Ohta et al., 2021; Nakajo et al., 2022; Rios et al., 2024; Ohta et al., 2026). At the end of mitosis, the PCM is dismantled in a process known as centrosome disassembly by the combined action of phosphatases and microtubule-mediated forces (Woodruff et al., 2014; Conduit et al., 2015; Enos et al., 2018). In C. elegans, dephosphorylation weakens SPD-5's intermolecular interactions, allowing microtubule-mediated forces to rip apart the PCM (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). In the 1-cell embryo, centrosome disassembly is asymmetric; in telophase, the anterior centrosome remains spherical while the posterior centrosome flattens due to microtubule-pulling forces (Strome and Wood, 1983; Keating and White, 1998; Hamill et al., 2002; Severson and Bowerman, 2003). Similar flattening is also observed in other organisms, such as the nematode Ascaris megalocephala (Boveri, 1900), the surf clam Spisula solidissima (Dan and Ito, 1984) and across multiple orders of sea urchins (Boveri, 1900; Dan, 1979; Endo, 1980; Paweletz et al., 1984). The role of centrosome flattening is not known.
In the C. elegans embryo, the centrosome is surrounded by a membrane reticulum called the centriculum (Maheshwari et al., 2023; Maheshwari et al., 2026). To follow the fate of the centriculum after metaphase, we visualized centrosomes by live fluorescent confocal microscopy using SPD-5 tagged with a fluorescence protein (FP). SPD-5 is commonly used for this purpose, and we had several such constructs on hand that have been previously used in the field [e.g. (Cabral et al., 2019; Magescas et al., 2019; Garbrecht et al., 2021; Magescas et al., 2021; Holzer et al., 2022; Garcia-Baucells et al., 2025)]. Using endogenously expressed tagRFP-T::SPD-5 (allele: wow36 (Magescas et al., 2019), henceforth “RFPend”), we observed the expected flattening of the posterior but not anterior centrosome (Fig. 1Ai and ix), similar to the centrosome flattening observed by indirect immunofluorescence [Fig. 1B and (Hamill et al., 2002; Severson and Bowerman, 2003; Enos et al., 2018)], and consistent with this allele's behavior in previous publications (Magescas et al., 2019; Rios et al., 2024; Schreiner et al., 2025). Unexpectedly, in strains expressing two different endogenously tagged GFP::SPD-5 constructs (vie26 (Cabral et al., 2019) and wow52 (Magescas et al., 2019), referred to here as GFP1end and GFP2end, respectively), the flattening of the posterior centrosome was abolished (Figs. 1Aii, iii and x). Despite the flattening defect, centrosomes in the GFP1end and GFP2end strains disassembled as in the RFP strain, as determined by the complete dispersal of SPD-5 fluorescence surrounding the centrioles (Figs 1Aix and x). To quantify the defect in flattening, embryos were imaged every minute starting at metaphase. Centrosome flattening began 4 minutes after metaphase and increased through 5 and 6 minutes. At 5 minutes, the PCM had begun disassembling into puncta that were occasionally too faint or disperse to measure. We thus quantified posterior centrosome flattening by measuring the length of the PCM long axis at 4 minutes after metaphase (Fig. 1C).
We classified any centrosome with a ≥ 5.0 µm PCM at 4 minutes post-metaphase as being flattened. In a strain expressing RFPend, posterior centrosomes flattened in 100% of embryos imaged (Figs. 1Ai, ix and 1C). In contrast, posterior centrosomes failed to flatten in the two GFP::SPD-5 strains, GFP1end and GFP2end, and posterior PCM lengths in these strains were significantly shorter than posterior RFPend centrosomes (Figs. 1Aii, iii, x, and 1C). In addition to the fluorescent tag, RFPend, GFP1end and GFP2end also differ in the linkers between the FP and SPD-5 (Fig. 1D). To determine whether these three constructs lead to a general difference in PCM morphology, we measured centrosome areas at metaphase (when centrosomes are spherical) and found no significant differences between the three strains (Fig. 1E).
We also examined centrosome flattening in a strain expressing GFP::SPD-5 as a transgene, (ltSi1141 (Woodruff et al., 2015), termed GFP3trans), in the presence of untagged endogenous SPD-5. GFP3trans's linker sequence is much shorter than those in GFP1end and GFP2end (Fig. 1D) but the GFP itself is identical between all three strains. Interestingly, nearly all centrosomes in GFP3trans flattened (Fig. 1C). This is consistent with Enos et al., (2018) and Erpf et al., (2019) who observed posterior centrosome flattening in strains expressing the same construct. Given the presence of the untagged endogenous SPD-5 in GFP3trans, we hypothesized that either the untagged endogenous protein was rescuing flattening by diluting GFP3trans, or GFP3trans itself permitted centrosome flattening.
To test if untagged SPD-5 can rescue centrosome flattening in the presence of GFP::SPD-5, we combined GFP1end with untagged transgenic SPD-5. 100% of centrosomes flattened in this strain (Figs. 1Av and 1C), suggesting that untagged SPD-5 can rescue centrosome flattening that is inhibited by the GFP::SPD-5 constructs used here. We next examined whether GFP3trans itself is permissive to centrosome flattening by combining it with GFP1end. We reasoned that if GFP3trans permits flattening in the presence of GFP1end, then GFP3trans behaves as an untagged SPD-5. Interestingly, in this GFP1end + GFP3trans strain, 44% of centrosomes flattened (Figs. 1Avi and vii, and 1C). GFP and other FPs can dimerize and perturb organelle morphology (Zacharias et al., 2002; Snapp et al., 2003; Costantini et al., 2012). In our case, the expression of GFP1end and GFP2end as the sole source of SPD-5 may have increased inter-GFP::SPD-5 interactions, thus preventing anaphase SPD-5 dispersal and consequently, centrosome flattening. The presence of untagged SPD-5 would increase the average distance between GFP1end or GFP2end molecules, reducing their ability to interact. GFP3trans has a much shorter linker than GFP1end or GFP2end (Fig. 1D); the short linker might constrain GFP3trans's dimerization, thus perturbing centrosome flattening to a lesser degree than GFP1end or GFP2end. Furthermore, in strains expressing both GFP3trans and GFP1end, posterior centrosome flattening might occur in embryos with higher relative levels of GFP3trans expression, while in embryos with higher relative GFP1end expression, flattening might be inhibited.
Thus far, the only strains that exhibited posterior centrosome flattening were RFPend and those expressing SPD-5 transgenes. We therefore sought to construct a strain expressing endogenously tagged “green” SPD-5 that exhibited wild type centrosome flattening without a transgene. To this end, we used super-folder GFP (sfGFP), which has been shown to be more monomeric than GFP by gel filtration, crystallography, and cell-based assays (Zacharias et al., 2002; Pedelacq et al., 2006; Costantini et al., 2012). Of note, recent reports using cell-based assays reported that sfGFP might dimerize, although less so than many other FPs, like tagRFP-T (Cranfill et al., 2016; Stoddard and Rolland, 2019; Fraikin et al., 2025). Using CRISPR-Cas9 gene editing, we tagged SPD-5 endogenously, affixing sfGFP to SPD-5's N-terminus via a 9 amino acid linker reminiscent of GFP3trans's linker (Fig. 1D). In this strain, where sfGFP::SPD-5 is the only source of SPD-5, 100% of posterior centrosomes flattened after metaphase (Figs. 1Aviii and 1C). Thus, we successfully constructed an endogenous green FP-tagged SPD-5 that retains normal centrosome morphology during late mitosis.
Whether FP dimerization is what led to a defect in centrosome flattening in the strains expressing GFP1end and GFP2end remains an open question. Beyond dimerization, FPs could disrupt PCM disassembly by interfering with microtubule nucleation or SPD-5's accessibility to phosphatases, as both microtubules and phosphatases are required for PCM disassembly (Enos et al., 2018; Magescas et al., 2019; Mittasch et al., 2020). The nature of the linker (Fig. 1D) could have also affected the properties of the FP::SPD-5 fusion proteins. It also remains unknown whether inhibiting centrosome flattening leads to a developmental defect; neither brood size nor embryonic viability was significantly different in strains without posterior centrosome flattening compared to a control expressing untagged SPD-5 (Fig. 1E). Either flattening, or lack thereof, has no functional importance, or the embryo has robust mechanisms to compensate for this defect. Thus, the consequences of abolishing posterior centrosome flattening should be examined further. In this regard, if the GFP1end and GFP2end SPD-5 fusion proteins do affect centrosome-related processes, there is a concern that they may exhibit synthetic genetic interactions under conditions that partially compromise centrosome function, even if these conditions, on their own, do not exhibit a centrosome defect. Finally, the GFP1end and GFP2end alleles provide useful tools that inhibit centrosome flattening without global disruption of microtubules, phosphatases, or motor proteins. Our study further underscores that PCM disassembly is sensitive to the properties of its constituent proteins.
","references":[{"reference":"Boveri, T. (1900). Ueber die Natur der Centrosomen. In Zellen-Studien (Vol. 4). Gustav Fischer. https://www.biodiversitylibrary.org/page/6303288?__cf_chl_f_tk=isKyV5iYcAKbMmWILzBkaRICOd_nvnOpACnVfVr9Udg-1783435793-1.0.1.1-Yokbr3F40lKm8gaHKAmFpvi576TxyuvGHnB4piuVk4Q#page/7/mode/1up (Jena, Germany: G. Fischer)
","pubmedId":"","doi":""},{"reference":"Brenner S. 1974. The genetics of Caenorhabditis elegans. Genetics 77: 71-94.
","pubmedId":"","doi":"10.1093/genetics/77.1.71"},{"reference":"Cabral G, Laos T, Dumont J, Dammermann A. 2019. Differential Requirements for Centrioles in Mitotic Centrosome Growth and Maintenance. Developmental Cell 50: 355-366.e6.
","pubmedId":"","doi":"10.1016/j.devcel.2019.06.004"},{"reference":"Conduit PT, Wainman A, Raff JW. 2015. Centrosome function and assembly in animal cells. Nature Reviews Molecular Cell Biology 16: 611-624.
","pubmedId":"","doi":"10.1038/nrm4062"},{"reference":"Costantini LM, Fossati M, Francolini M, Snapp EL. 2012. Assessing the Tendency of Fluorescent Proteins to Oligomerize Under Physiologic Conditions. Traffic 13: 643-649.
","pubmedId":"","doi":"10.1111/j.1600-0854.2012.01336.x"},{"reference":"Cranfill PJ, Sell BR, Baird MA, Allen JR, Lavagnino Z, de Gruiter HM, et al., Piston. 2016. Quantitative assessment of fluorescent proteins. Nature Methods 13: 557-562.
","pubmedId":"","doi":"10.1038/nmeth.3891"},{"reference":"Dan K. 1979. Studies on unequal cleavage in sea urchins I. migration of the nuclei to the vegetal pole. Development, Growth and Differentiation 21: 527-535.
","pubmedId":"","doi":"10.1111/j.1440-169X.1979.00527.x"},{"reference":"Dan K, Ito S. 1984. Studies of Unequal Cleavage in Molluscs: I. Nuclear Behavior and Anchorage of a Spindle Pole to Cortex as Revealed by Isolation Technique. Development, Growth & Differentiation 26: 249-262.
","pubmedId":"","doi":"10.1111/j.1440-169X.1984.00249.x"},{"reference":"Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. 2015. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics 200: 1035-1049.
","pubmedId":"","doi":"10.1534/genetics.115.178335"},{"reference":"Dickinson DJ, Ward JD, Reiner DJ, Goldstein B. 2013. Engineering the Caenorhabditis elegans genome using Cas9-triggered homologous recombination. Nature Methods 10: 1028-1034.
","pubmedId":"","doi":"10.1038/nmeth.2641"},{"reference":"Endo S. 1980. Further observations on the clusters of granular material around the centriole in the sea urchin egg: changes in distribution during mitosis*. Development, Growth and Differentiation 22: 509-516.
","pubmedId":"","doi":"10.1111/j.1440-169X.1980.00509.x"},{"reference":"Enos SJ, Dressler M, Gomes BF, Hyman AA, Woodruff JB. 2017. Phosphatase PP2A and microtubule-mediated pulling forces disassemble centrosomes during mitotic exit. Biology Open : 10.1242/bio.029777.
","pubmedId":"","doi":"10.1242/bio.029777"},{"reference":"Erpf AC, Stenzel L, Memar N, Antoniolli M, Osepashvili M, Schnabel R, Conradt B, Mikeladze-Dvali T. 2019. PCMD-1 Organizes Centrosome Matrix Assembly in C. elegans. Current Biology 29: 1324-1336.e6.
","pubmedId":"","doi":"10.1016/j.cub.2019.03.029"},{"reference":"Fraikin N, Couturier A, Mercier R, Lesterlin C. 2025. A palette of bright and photostable monomeric fluorescent proteins for bacterial time-lapse imaging. Science Advances 11: 10.1126/sciadv.ads6201.
","pubmedId":"","doi":"10.1126/sciadv.ads6201"},{"reference":"Frøkjær-Jensen C, Wayne Davis M, Hopkins CE, Newman BJ, Thummel JM, Olesen SrP, Grunnet M, Jorgensen EM. 2008. Single-copy insertion of transgenes in Caenorhabditis elegans. Nature Genetics 40: 1375-1383.
","pubmedId":"","doi":"10.1038/ng.248"},{"reference":"Garbrecht J, Laos T, Holzer E, Dillinger M, Dammermann A. 2021. An acentriolar centrosome at the C. elegans ciliary base. Current Biology 31: 2418-2428.e8.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.023"},{"reference":"Garcia-Baucells Jl, Bevilacqua C, Rufin M, Rumpf-Kienzl C, Zampetaki A, Andriotis OG, et al., Dammermann. 2025. Centrosome Softening As A Mechanical Adaptation For Mitosis. : 10.1101/2025.09.09.675178.
","pubmedId":"","doi":"10.1101/2025.09.09.675178"},{"reference":"Green RA, Audhya A, Pozniakovsky A, Dammermann A, Pemble H, Monen J, et al., Oegema. 2008. Expression and Imaging of Fluorescent Proteins in the C. elegans Gonad and Early Embryo. Methods in Cell Biology,Fluorescent Proteins : 179-218.
","pubmedId":"","doi":"10.1016/S0091-679X(08)85009-1"},{"reference":"Greenan G, Brangwynne CP, Jaensch S, Gharakhani Jb, Jülicher F, Hyman AA. 2010. Centrosome Size Sets Mitotic Spindle Length in Caenorhabditis elegans Embryos. Current Biology 20: 353-358.
","pubmedId":"","doi":"10.1016/j.cub.2009.12.050"},{"reference":"Hamill DR, Severson AF, Carter JC, Bowerman B. 2002. Centrosome Maturation and Mitotic Spindle Assembly in C. elegans Require SPD-5, a Protein with Multiple Coiled-Coil Domains. Developmental Cell 3: 673-684.
","pubmedId":"","doi":"10.1016/s1534-5807(02)00327-1"},{"reference":"Holzer E, Rumpf-Kienzl C, Falk S, Dammermann A. 2022. A modified TurboID approach identifies tissue-specific centriolar components in C. elegans. PLOS Genetics 18: e1010150.
","pubmedId":"","doi":"10.1371/journal.pgen.1010150"},{"reference":"Joseph-Strauss D, Gorjánácz Mts, Santarella-Mellwig R, Voronina E, Audhya A, Cohen-Fix O. 2012. Sm protein down-regulation leads to defects in nuclear pore complex disassembly and distribution in C. elegans embryos. Developmental Biology 365: 445-457.
","pubmedId":"","doi":"10.1016/j.ydbio.2012.02.036"},{"reference":"Keating HH, White JG. 1998. Centrosome dynamics in early embryos of Caenorhabditis elegans. Journal of Cell Science 111: 3027-3033.
","pubmedId":"","doi":"10.1242/jcs.111.20.3027"},{"reference":"Magescas Jrm, Eskinazi S, Tran MV, Feldman JL. 2021. Centriole-less pericentriolar material serves as a microtubule organizing center at the base of C. elegans sensory cilia. Current Biology 31: 2410-2417.e6.
","pubmedId":"","doi":"10.1016/j.cub.2021.03.022"},{"reference":"Magescas Jrm, Zonka JC, Feldman JL. 2019. A two-step mechanism for the inactivation of microtubule organizing center function at the centrosome. eLife 8: 10.7554/elife.47867.
","pubmedId":"","doi":"10.7554/eLife.47867"},{"reference":"Maheshwari R, Rahman MM, Drey S, Onyundo M, Fabig G, Martinez MAQ, et al., Cohen-Fix. 2023. A membrane reticulum, the centriculum, affects centrosome size and function in Caenorhabditis elegans. Current Biology 33: 791-806.e7.
","pubmedId":"","doi":"10.1016/j.cub.2022.12.059"},{"reference":"Maheshwari R, Rahman MM, Ruddick A, Drey S, Mirabello RS, Cohen-Fix O. 2026. The centriculum, a membrane reticulum that surrounds\n Caenorhabditis elegans\n centrosomes, might serve as a microtubule filter. Journal of Cell Science 139: 10.1242/jcs.264404.
","pubmedId":"","doi":"10.1242/jcs.264404"},{"reference":"Mittasch Mu, Tran VM, Rios MU, Fritsch AW, Enos SJ, Ferreira Gomes B, et al., Woodruff. 2020. Regulated changes in material properties underlie centrosome disassembly during mitotic exit. Journal of Cell Biology 219: 10.1083/jcb.201912036.
","pubmedId":"","doi":"10.1083/jcb.201912036"},{"reference":"Nakajo M, Kano H, Tsuyama K, Haruta N, Sugimoto A. 2022. Centrosome maturation requires phosphorylation-mediated sequential domain interactions of SPD-5. Journal of Cell Science 135: 10.1242/jcs.259025.
","pubmedId":"","doi":"10.1242/jcs.259025"},{"reference":"Nigg EA, Raff JW. 2009. Centrioles, Centrosomes, and Cilia in Health and Disease. Cell 139: 663-678.
","pubmedId":"","doi":"10.1016/j.cell.2009.10.036"},{"reference":"Noteborn WEM, Abendstein L, Sharp TH. 2020. One-Pot Synthesis of Defined-Length ssDNA for Multiscaffold DNA Origami. Bioconjugate Chemistry 32: 94-98.
","pubmedId":"","doi":"10.1021/acs.bioconjchem.0c00644"},{"reference":"Ohta M, Arakawa O, Gu Y, Tian W, Corbett KD, Desai A, Oegema K. 2026. Phosphorylation remodels the mitotic centrosome matrix to generate bipartite γ-tubulin complex docking sites. Science Advances 12: 10.1126/sciadv.aed6539.
","pubmedId":"","doi":"10.1126/sciadv.aed6539"},{"reference":"Ohta M, Zhao Z, Wu D, Wang S, Harrison JL, Gómez-Cavazos JSn, Desai A, Oegema KF. 2021. Polo-like kinase 1 independently controls microtubule-nucleating capacity and size of the centrosome. Journal of Cell Biology 220: 10.1083/jcb.202009083.
","pubmedId":"","doi":"10.1083/jcb.202009083"},{"reference":"Paix A, Folkmann A, Seydoux G. 2017. Precision genome editing using CRISPR-Cas9 and linear repair templates in C. elegans. Methods 121-122: 86-93.
","pubmedId":"","doi":"10.1016/j.ymeth.2017.03.023"},{"reference":"Paweletz N, Mazia D, Finze EM. 1984. The centrosome cycle in the mitotic cycle of sea urchin eggs. Experimental Cell Research 152: 47-65.
","pubmedId":"","doi":"10.1016/0014-4827(84)90229-5"},{"reference":"Pédelacq JD, Cabantous Sp, Tran T, Terwilliger TC, Waldo GS. 2005. Engineering and characterization of a superfolder green fluorescent protein. Nature Biotechnology 24: 79-88.
","pubmedId":"","doi":"10.1038/nbt1172"},{"reference":"Rios MU, Bagnucka MgA, Ryder BD, Ferreira Gomes B, Familiari NE, Yaguchi K, et al., Woodruff. 2024. Multivalent coiled-coil interactions enable full-scale centrosome assembly and strength. Journal of Cell Biology 223: 10.1083/jcb.202306142.
","pubmedId":"","doi":"10.1083/jcb.202306142"},{"reference":"Schindelin J, Arganda-Carreras I, Frise E, Kaynig V, Longair M, Pietzsch T, et al., Cardona. 2012. Fiji: an open-source platform for biological-image analysis. Nature Methods 9: 676-682.
","pubmedId":"","doi":"10.1038/nmeth.2019"},{"reference":"Schreiner A, Heim A, Pletschacher L, Alznauer LM, Schwenkert S, Wolff F, Zanin E, Mikeladze-Dvali T. 2025. PCMD-1 stabilizes the PCM scaffold and facilitates centriole separation. Journal of Cell Biology 224: 10.1083/jcb.202411107.
","pubmedId":"","doi":"10.1083/jcb.202411107"},{"reference":"Severson AF, Bowerman B. 2003. Myosin and the PAR proteins polarize microfilament-dependent forces that shape and position mitotic spindles in Caenorhabditis elegans . The Journal of Cell Biology 161: 21-26.
","pubmedId":"","doi":"10.1083/jcb.200210171"},{"reference":"Snapp EL, Hegde RS, Francolini M, Lombardo F, Colombo S, Pedrazzini E, Borgese N, Lippincott-Schwartz J. 2003. Formation of stacked ER cisternae by low affinity protein interactions. The Journal of Cell Biology 163: 257-269.
","pubmedId":"","doi":"10.1083/jcb.200306020"},{"reference":"Stoddard A, Rolland V. 2019. I see the light! Fluorescent proteins suitable for cell wall/apoplast targeting in\n Nicotiana benthamiana\n leaves. Plant Direct 3: 10.1002/pld3.112.
","pubmedId":"","doi":"10.1002/pld3.112"},{"reference":"Strome S, Wood WB. 1983. Generation of asymmetry and segregation of germ-line granules in early C. elegans embryos. Cell 35: 15-25.
","pubmedId":"","doi":"10.1016/0092-8674(83)90203-9"},{"reference":"Tsien RY. 1998. THE GREEN FLUORESCENT PROTEIN. Annual Review of Biochemistry 67: 509-544.
","pubmedId":"","doi":"10.1146/annurev.biochem.67.1.509"},{"reference":"Woodruff JB, Ferreira Gomes B, Widlund PO, Mahamid J, Honigmann A, Hyman AA. 2017. The Centrosome Is a Selective Condensate that Nucleates Microtubules by Concentrating Tubulin. Cell 169: 1066-1077.e10.
","pubmedId":"","doi":"10.1016/j.cell.2017.05.028"},{"reference":"Woodruff JB, Wueseke O, Hyman AA. 2014. Pericentriolar material structure and dynamics. Philosophical Transactions of the Royal Society B: Biological Sciences 369: 20130459.
","pubmedId":"","doi":"10.1098/rstb.2013.0459"},{"reference":"Woodruff JB, Wueseke O, Viscardi V, Mahamid J, Ochoa SD, Bunkenborg J, et al., Hyman. 2015. Regulated assembly of a supramolecular centrosome scaffold in vitro. Science 348: 808-812.
","pubmedId":"","doi":"10.1126/science.aaa3923"},{"reference":"Wueseke O, Zwicker D, Schwager A, Wong YL, Oegema K, Jülicher F, Hyman AA, Woodruff JB. 2016. Polo-like kinase phosphorylation determines\n Caenorhabditis\n elegans\n centrosome size and density by biasing SPD-5 toward an assembly-competent conformation. Biology Open 5: 1431-1440.
","pubmedId":"","doi":"10.1242/bio.020990"},{"reference":"Zacharias DA, Violin JD, Newton AC, Tsien RY. 2002. Partitioning of Lipid-Modified Monomeric GFPs into Membrane Microdomains of Live Cells. Science 296: 913-916.
","pubmedId":"","doi":"10.1126/science.1068539%208539%20068539"}],"title":"Tags Attached to the Centrosomal Protein SPD-5 Can Disrupt Centrosome Flattening During Anaphase of the 1-cell C. elegans Embryo
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1790016292497"}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"cd33d1dd-9987-42a7-a663-0741e5eadb19","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}