The relationship between developmental signaling pathways and basic metabolism in zebrafish embryonic hearts is not well-known. Considering the key role of canonical Wnt signaling in zebrafish cardiac development, our study analyzes the Wnt responsiveness of phosphoglycerate mutase 2 (pgam2), which catalyzes the glycolytic conversion of 3-phosphoglycerate to 2-phosphoglycerate. However, it recently emerged as a gateway between glycolytic and cholesterol metabolism for its intersection with ATP generation in the cell. Since Pgam2 is linked to overall metabolic homeostasis and multiple cardiovascular diseases (CVDs), it represents a perfect candidate to dissect the Wnt role in the basic metabolism of developing cardiomyocytes.
The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by Florida Gulf Coast University (FGCU) startup funds (PI: Ugo Coppola).
A) qPCR analysis of pgam2 genes in untreated WT embryos vs isolated hearts at 48 hpf. B) Effects of BIO/XAV939 treatments on pgam2 in WT embryos. C) Effects of BIO/XAV939 treatments on pgam2 in hearts. D) Combined effect of BIO and DEAB treatment on pgam2 in WT embryos. E) Combined effect of BIO and DEAB treatment on pgam2 in hearts. Fold difference is relative to β-actin. Error bars in the graph indicate s.e.m. * indicates P < 0.05, ** indicates P < 0.01, **** indicates P < 0.0001.
Wnt manipulation affects pgam2 gene expression in zebrafish cardiomyocytes
","methods":"Zebrafish maintenance: All zebrafish husbandry and experiments were performed following protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Florida Gulf Coast University (# 2412000066A002). Adult zebrafish were raised and maintained following standard laboratory conditions and guidelines (Westerfield 2007). All the WT fish used were mixed AB-TL backgrounds. The only transgenic line employed was Tg(-5.1myl7:EGFP) (Huang et al. 2003). Embryos were raised at 28.5 °C in blue water and staged by hpf and dpf.
Pharmacological approach: Each drug treatment was carried out on embryos (20s-48 hpf stages) in 2 mL of blue water with drugs at specific concentrations in 3 mL glass vials (30 embryos/vial). Treated embryos in vials were placed on a nutator in an incubator at 28.5˚C for the duration of the treatments. Drug concentrations were previously indicated (Coppola et al. 2024): 2.5 μM DEAB (Sigma-Aldrich, Cat # D86256), 5 μM BIO (Tocris, Cat # 3194), 10 μM XAV939 (Tocris, Cat # 3748). All the drugs were washed employing blue water 3 times at 48 hpf before heart isolation procedure.
Heart isolation: Hearts from untreated (WT) and treated zebrafish at 48 hpf were isolated, as previously described (Burns and MacRae 2006; Coppola et al. 2024; DeWildt et al. 2026). ~500 embryos of the aforementioned transgenic line were anesthetized with tricaine and transferred to a sterile 1.5 mL microcentrifuge tube. They were then washed on ice 4 times in cold embryo disruption media (EDM, Gibco Leibovitz’s L-15 Medium, Cat # 11415114) with 10% fetal bovine serum (FBS, Gibco, Cat # 26140079). Embryos were placed in 1.25 mL EDM and triturated for approximately 1 minute using a syringe (1 sec rate) positioned on a ring stand. The fragments were transferred to a 105 mM mesh with 0.5 mL EDM, and immediately to a 40 mM mesh with additional EDM. Finally, the GFP+ hearts were selected utilizing an Olympus SZ51 Stereoscope and placed in clean EDM. The hearts were centrifugated and immediately pelleted at 1300 rpm for 5 minutes. RNA extraction was carried out employing the Single Cell RNA Purification Kit (Norgen Biotek, Cat # 51800). cDNAs were synthetised using iScript™ cDNA Synthesis Kit (Bio-RAD, cat #1708890).
qPCR analyses: experiments were performed as previously described (D’Aniello et al. 2013; Coppola et al. 2024; DeWildt et al. 2026), employing Power SYBR Green PCR Master Mix (Applied Biosystems, Cat # 4368706) in a BioRad CFX-96 PCR machine. Expression levels were normalized against β-actin expression and results were analyzed using the Livak 2-ΔΔCT Method (D’Aniello et al. 2013). Each experiment was performed in triplicate. Pgam2 primers were: pgam2fw (AAAACCGTTTCTGCGGCTGG) and pgam2rev (CCATGTTTGGCTGCTGTCTC). The significance of qPCRs was assessed with a three-way ANOVA with Dunnett’s correction for experiments with 3 samples and Student’s t-test with Welch’s correction with 2 samples. p value <0.05 was considered statistically significant.
Description
Zebrafish emerged as a model for investigating cellular metabolism, with multiple direct implications in the context of metabolic diseases (Benchoula et al. 2019). While recently connected (Iwata and Vanderhaeghen 2024), the relationships existing among developmental pathways and metabolic processes are still very obscure. Intriguingly, Wnt pathway disruptions have been associated with multiple metabolic defects in mammals (Abou Azar and Lim 2021), with mutations in the transcription factor TCF7L2 causing severe metabolic phenotypes in mice (Nguyen-Tu et al. 2021). With respect to the metabolic aspects in cardiac development and disease, zebrafish has been established as a key model for its versatility (Angom and Nakka 2024). Additionally, canonical Wnt signaling represents a fundamental asset in the regulation of zebrafish cardiac development (Ueno et al. 2007), with a conserved role in mammalian models (Liang et al. 2020). Therefore, in light of its key role in the regulation of critical steps in cellular metabolism (Guo et al. 2024), we tested the impact of Wnt signaling on pgam2 (Singh et al. 2023) through an established pharmacological approach (Coppola et al. 2024) in both WT whole-embryo and cardiomyocytes (Figure 1). First, we compared the expression level of pgam2 between WT whole embryos and isolated hearts (Fig. 1A), detecting a moderate increase in cardiomyocytes (CMs). To understand the impact of Wnt signaling on pgam2 during early development, we measured its expression levels in treated embryos with both an activator (BIO) and an inhibitor (XAV939) (Fig. 1B). Pgam2 resulted in an increase in BIO-treated samples, while was reduced in XAV939 conditions (Fig. 1B). In order to detect this relationship in CMs, we performed the same treatments on myl7:EGFP transgenic embryos and measured pgam2 expression levels (Fig. 1C). Intriguingly, the effect of BIO on pgam2 expression in CMs is very strong, with a net increase in comparison with WT whole embryos (Fig. 1B), suggesting a stronger effect of Wnt on this important metabolic gene in the heart. Since retinoic acid (RA) represents a significant pathway in the homeostasis of early vertebrate embryos and their hearts (D’Aniello et al. 2013) and a general regulator of metabolic balance (El Haddad et al. 2017), we tested the RA effect on the Wnt-pgam2 relationship through a functional epistatic approach (Fig. 1D-E). Combining the effect of BIO with DEAB (RA inhibitor) in WT embryos caused a decrease in pgam2 expression (Fig. 1D). On the other hand, the same epistatic approach caused a reduction of pgam2 expression compared to BIO alone in CMs (Fig. 1E). Intriguingly, the effect of RA inhibition is similar between WT and isolated hearts, suggesting a combined role of Wnt and RA in the regulation of pgam2 during zebrafish development. Here, we report the first study on the relationship between the Wnt pathway and Pgam2 in zebrafish hearts. While the role of Wnt in the metabolic reprogramming in tumors has been already indicated (Koushyar et al. 2022; Tümen et al. 2024), the relationship between Wnt and basic metabolism in zebrafish heart and cardiovascular pathologies has not been clarified. For its well-known versatility as a model system in development and disease (Westerfield 2007) and the recent significance in metabolic studies (Benchoula et al. 2019; Abou Azar and Lim 2021), zebrafish represent a valid target to study metabolic physiological interactions. Through well-established pharmacological manipulations (Coppola et al. 2024; DeWildt et al. 2026), we detected a clear control exerted by Wnt on pgam2 during zebrafish early development. Specifically, we registered higher pgam2 expression in CMs and higher effect of Wnt on gene expression in isolated hearts, suggesting a more relevant effect/control in cardiovascular development. Intriguingly, our epistatic approaches unveiled a contribution of the retinoic acid (RA) in the relationship existing between Wnt and pgam2 in zebrafish CMs. Our approach suggests a potential RA-Wnt interaction in the control of pgam2 expression in the heart, with Wnt playing a major role in this context. Additionally, since Pgam2 has a significant role in the control of the balance between glycolytic pathway and cholesterol metabolism (Guo et al. 2024), our data pave the way to further experiments towards the understanding of Wnt impact of general metabolism in the heart. Furthermore, both the incidence of Wnt defects on mammalian metabolic homeostasis (Abou Azar and Lim 2021) and the implication of TCF7L2 mutations in murine overt metabolic phenotypes (Nguyen-Tu et al. 2021) align with our pharmacological approach. Henceforth, our analysis data speak in favor of a conserved Wnt involvement in the regulation of a key metabolic gene, pgam2, in the context of heart development. Intriguingly, human PGAM2 gene has been associated with Glycogen Storage Disease Type X (GSD X) (Tsujino et al. 1993; Hadjigeorgiou et al. 1999; Nayab et al. 2021), which severely affects muscle basic functionalities. Furthermore, murine Pgam2 overexpression causes cardiac weakness (Okuda et al. 2013) and human PGAM2 resulted in overexpression in patients affected by heart failure (Li et al. 2021), both supporting its involvement in the regulation of basic cardiac development. With respect to PGAM2 implication in cardiac defects, it has been identified as a marker for cardiac ischemia (Li et al. 2012) and associated with cardiac hypertrophic conditions (Li et al. 2025). In light of the significance of Pgam2 orthologs in cardiac development/disease and in the balance among distinct metabolic pathways (Guo et al. 2024), future studies will be directed at deciphering the role of Wnt in the regulation/control of genes within specific metabolic pathways (glycolysis, cholesterol, TCA), shedding light on novel Wnt-dependent potential gene regulatory networks (GRNs) in zebrafish (and vertebrate) hearts.
Pilot: Wnt signaling controls pgam2 expression in zebrafish cardiomyocytes
The relationship between developmental signaling pathways and basic metabolism in zebrafish embryonic hearts is not well-known. Considering the key role of canonical Wnt signaling in zebrafish cardiac development, our study analyzes the Wnt responsiveness of phosphoglycerate mutase 2 (pgam2), which catalyzes the glycolytic conversion of 3-phosphoglycerate to 2-phosphoglycerate. However, it recently emerged as a gateway between glycolytic and cholesterol metabolism for its intersection with ATP generation in the cell. Since Pgam2 is linked to overall metabolic homeostasis and multiple cardiovascular diseases (CVDs), it represents a perfect candidate to dissect the Wnt role in the basic metabolism of developing cardiomyocytes.
","acknowledgements":"","authors":[{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Department of Biological Sciences"],"credit":["formalAnalysis","methodology","investigation"],"email":"mahildenbrand0876@eagle.fgcu.edu","firstName":"Madisyn","lastName":"Hildenbrand","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University"],"departments":["Biological Sciences"],"credit":["methodology","investigation"],"email":"klako7420@eagle.fgcu.edu","firstName":"Klejdi ","lastName":"Lako","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Biological Sciences"],"credit":["conceptualization","investigation","fundingAcquisition","resources","supervision","dataCuration","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"ucoppola@fgcu.edu","firstName":"Ugo","lastName":"Coppola","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8479-2401"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by Florida Gulf Coast University (FGCU) startup funds (PI: Ugo Coppola).
A) qPCR analysis of pgam2 genes in untreated WT embryos vs isolated hearts at 48 hpf. B) Effects of BIO/XAV939 treatments on pgam2 in WT embryos. C) Effects of BIO/XAV939 treatments on pgam2 in hearts. D) Combined effect of BIO and DEAB treatment on pgam2 in WT embryos. E) Combined effect of BIO and DEAB treatment on pgam2 in hearts. Fold difference is relative to β-actin. Error bars in the graph indicate s.e.m. * indicates P < 0.05, ** indicates P < 0.01, **** indicates P < 0.0001.
","imageTitle":"Wnt manipulation affects pgam2 gene expression in zebrafish cardiomyocytes
","methods":"Zebrafish maintenance: All zebrafish husbandry and experiments were performed following protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Florida Gulf Coast University (# 2412000066A002). Adult zebrafish were raised and maintained following standard laboratory conditions and guidelines (Westerfield 2007). All the WT fish used were mixed AB-TL backgrounds. The only transgenic line employed was Tg(-5.1myl7:EGFP) (Huang et al. 2003). Embryos were raised at 28.5 °C in blue water and staged by hpf and dpf.
Pharmacological approach: Each drug treatment was carried out on embryos (20s-48 hpf stages) in 2 mL of blue water with drugs at specific concentrations in 3 mL glass vials (30 embryos/vial). Treated embryos in vials were placed on a nutator in an incubator at 28.5˚C for the duration of the treatments. Drug concentrations were previously indicated (Coppola et al. 2024): 2.5 μM DEAB (Sigma-Aldrich, Cat # D86256), 5 μM BIO (Tocris, Cat # 3194), 10 μM XAV939 (Tocris, Cat # 3748). All the drugs were washed employing blue water 3 times at 48 hpf before heart isolation procedure.
Heart isolation: Hearts from untreated (WT) and treated zebrafish at 48 hpf were isolated, as previously described (Burns and MacRae 2006; Coppola et al. 2024; DeWildt et al. 2026). ~500 embryos of the aforementioned transgenic line were anesthetized with tricaine and transferred to a sterile 1.5 mL microcentrifuge tube. They were then washed on ice 4 times in cold embryo disruption media (EDM, Gibco Leibovitz’s L-15 Medium, Cat # 11415114) with 10% fetal bovine serum (FBS, Gibco, Cat # 26140079). Embryos were placed in 1.25 mL EDM and triturated for approximately 1 minute using a syringe (1 sec rate) positioned on a ring stand. The fragments were transferred to a 105 mM mesh with 0.5 mL EDM, and immediately to a 40 mM mesh with additional EDM. Finally, the GFP+ hearts were selected utilizing an Olympus SZ51 Stereoscope and placed in clean EDM. The hearts were centrifugated and immediately pelleted at 1300 rpm for 5 minutes. RNA extraction was carried out employing the Single Cell RNA Purification Kit (Norgen Biotek, Cat # 51800). cDNAs were synthetised using iScript™ cDNA Synthesis Kit (Bio-RAD, cat #1708890).
qPCR analyses: experiments were performed as previously described (D’Aniello et al. 2013; Coppola et al. 2024; DeWildt et al. 2026), employing Power SYBR Green PCR Master Mix (Applied Biosystems, Cat # 4368706) in a BioRad CFX-96 PCR machine. Expression levels were normalized against β-actin expression and results were analyzed using the Livak 2-ΔΔCT Method (D’Aniello et al. 2013). Each experiment was performed in triplicate. Pgam2 primers were: pgam2fw (AAAACCGTTTCTGCGGCTGG) and pgam2rev (CCATGTTTGGCTGCTGTCTC). The significance of qPCRs was assessed with a three-way ANOVA with Dunnett’s correction for experiments with 3 samples and Student’s t-test with Welch’s correction with 2 samples. p value <0.05 was considered statistically significant.
","reagents":"","patternDescription":"Zebrafish emerged as a model for investigating cellular metabolism, with multiple direct implications in the context of metabolic diseases (Benchoula et al. 2019). While recently connected (Iwata and Vanderhaeghen 2024), the relationships existing among developmental pathways and metabolic processes are still very obscure. Intriguingly, Wnt pathway disruptions have been associated with multiple metabolic defects in mammals (Abou Azar and Lim 2021), with mutations in the transcription factor TCF7L2 causing severe metabolic phenotypes in mice (Nguyen-Tu et al. 2021). With respect to the metabolic aspects in cardiac development and disease, zebrafish has been established as a key model for its versatility (Angom and Nakka 2024). Additionally, canonical Wnt signaling represents a fundamental asset in the regulation of zebrafish cardiac development (Ueno et al. 2007), with a conserved role in mammalian models (Liang et al. 2020). Therefore, in light of its key role in the regulation of critical steps in cellular metabolism (Guo et al. 2024), we tested the impact of Wnt signaling on pgam2 (Singh et al. 2023) through an established pharmacological approach (Coppola et al. 2024) in both WT whole-embryo and cardiomyocytes (Figure 1). First, we compared the expression level of pgam2 between WT whole embryos and isolated hearts (Fig. 1A), detecting a moderate increase in cardiomyocytes (CMs). To understand the impact of Wnt signaling on pgam2 during early development, we measured its expression levels in treated embryos with both an activator (BIO) and an inhibitor (XAV939) (Fig. 1B). Pgam2 resulted in an increase in BIO-treated samples, while was reduced in XAV939 conditions (Fig. 1B). In order to detect this relationship in CMs, we performed the same treatments on myl7:EGFP transgenic embryos and measured pgam2 expression levels (Fig. 1C). Intriguingly, the effect of BIO on pgam2 expression in CMs is very strong, with a net increase in comparison with WT whole embryos (Fig. 1B), suggesting a stronger effect of Wnt on this important metabolic gene in the heart. Since retinoic acid (RA) represents a significant pathway in the homeostasis of early vertebrate embryos and their hearts (D’Aniello et al. 2013) and a general regulator of metabolic balance (El Haddad et al. 2017), we tested the RA effect on the Wnt-pgam2 relationship through a functional epistatic approach (Fig. 1D-E). Combining the effect of BIO with DEAB (RA inhibitor) in WT embryos caused a decrease in pgam2 expression (Fig. 1D). On the other hand, the same epistatic approach caused a reduction of pgam2 expression compared to BIO alone in CMs (Fig. 1E). Intriguingly, the effect of RA inhibition is similar between WT and isolated hearts, suggesting a combined role of Wnt and RA in the regulation of pgam2 during zebrafish development. Here, we report the first study on the relationship between the Wnt pathway and Pgam2 in zebrafish hearts. While the role of Wnt in the metabolic reprogramming in tumors has been already indicated (Koushyar et al. 2022; Tümen et al. 2024), the relationship between Wnt and basic metabolism in zebrafish heart and cardiovascular pathologies has not been clarified. For its well-known versatility as a model system in development and disease (Westerfield 2007) and the recent significance in metabolic studies (Benchoula et al. 2019; Abou Azar and Lim 2021), zebrafish represent a valid target to study metabolic physiological interactions. Through well-established pharmacological manipulations (Coppola et al. 2024; DeWildt et al. 2026), we detected a clear control exerted by Wnt on pgam2 during zebrafish early development. Specifically, we registered higher pgam2 expression in CMs and higher effect of Wnt on gene expression in isolated hearts, suggesting a more relevant effect/control in cardiovascular development. Intriguingly, our epistatic approaches unveiled a contribution of the retinoic acid (RA) in the relationship existing between Wnt and pgam2 in zebrafish CMs. Our approach suggests a potential RA-Wnt interaction in the control of pgam2 expression in the heart, with Wnt playing a major role in this context. Additionally, since Pgam2 has a significant role in the control of the balance between glycolytic pathway and cholesterol metabolism (Guo et al. 2024), our data pave the way to further experiments towards the understanding of Wnt impact of general metabolism in the heart. Furthermore, both the incidence of Wnt defects on mammalian metabolic homeostasis (Abou Azar and Lim 2021) and the implication of TCF7L2 mutations in murine overt metabolic phenotypes (Nguyen-Tu et al. 2021) align with our pharmacological approach. Henceforth, our analysis data speak in favor of a conserved Wnt involvement in the regulation of a key metabolic gene, pgam2, in the context of heart development. Intriguingly, human PGAM2 gene has been associated with Glycogen Storage Disease Type X (GSD X) (Tsujino et al. 1993; Hadjigeorgiou et al. 1999; Nayab et al. 2021), which severely affects muscle basic functionalities. Furthermore, murine Pgam2 overexpression causes cardiac weakness (Okuda et al. 2013) and human PGAM2 resulted in overexpression in patients affected by heart failure (Li et al. 2021), both supporting its involvement in the regulation of basic cardiac development. With respect to PGAM2 implication in cardiac defects, it has been identified as a marker for cardiac ischemia (Li et al. 2012) and associated with cardiac hypertrophic conditions (Li et al. 2025). In light of the significance of Pgam2 orthologs in cardiac development/disease and in the balance among distinct metabolic pathways (Guo et al. 2024), future studies will be directed at deciphering the role of Wnt in the regulation/control of genes within specific metabolic pathways (glycolysis, cholesterol, TCA), shedding light on novel Wnt-dependent potential gene regulatory networks (GRNs) in zebrafish (and vertebrate) hearts.
Pilot: Wnt signaling controls pgam2 expression in zebrafish cardiomyocytes
","reviews":[{"reviewer":{"displayName":"Raffaella De Paolo"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]},{"id":"32bd048c-f373-44e8-a525-c96a32760199","decision":"accept","abstract":"The relationship between developmental signaling pathways and basic metabolism in zebrafish embryonic hearts is not well-known. Considering the key role of canonical Wnt signaling in zebrafish cardiac development, our study analyzes the responsiveness to Wnt of phosphoglycerate mutase 2 (pgam2), which catalyzes the glycolytic conversion of 3-phosphoglycerate to 2-phosphoglycerate. Notably, Pgam2 recently emerged as a gateway between glycolytic and cholesterol metabolism for its intersection with ATP generation in the cell. Since Pgam2 is linked to overall metabolic homeostasis and multiple cardiovascular diseases (CVDs), it represents a perfect candidate to dissect the Wnt involvement in the basic metabolism of developing cardiomyocytes.
","acknowledgements":"We thank Dr Sherri Emer, Dr Lyndsay Rhodes and Lea Ann Panek for their help. We thank Dr Elena Albizzati for her suggestions in manuscript preparation.
","authors":[{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Department of Biological Sciences"],"credit":["formalAnalysis","methodology","investigation"],"email":"mahildenbrand0876@eagle.fgcu.edu","firstName":"Madisyn A.","lastName":"Hildenbrand","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States","University of South Carolina, Columbia, SC, United States"],"departments":["Department of Biological Sciences","Department of Biological Sciences"],"credit":["methodology","investigation"],"email":"klako7420@eagle.fgcu.edu","firstName":"Klejdi ","lastName":"Lako","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Department of Biological Sciences"],"credit":["conceptualization","investigation","fundingAcquisition","resources","supervision","dataCuration","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"ucoppola@fgcu.edu","firstName":"Ugo","lastName":"Coppola","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8479-2401"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by Florida Gulf Coast University (FGCU) startup funds (PI: Ugo Coppola).
A) qPCR analysis of pgam2 gene in untreated WT embryos vs isolated hearts at 48 hpf. B) Effects of BIO/XAV939 treatments on pgam2 expression WT whole embryos. C) Effects of BIO/XAV939 treatments on pgam2 expression in isolated hearts at 48 hpf. D) Combined effect of BIO and DEAB treatment on pgam2 expression in WT whole embryos at 48 hpf. E) Combined effect of BIO and DEAB treatment on pgam2 expression in isolated hearts at 48 hpf. Fold difference is relative to β-actin. Error bars in the graph indicate s.e.m. * indicates P < 0.05, ** indicates P < 0.01, **** indicates P < 0.0001. E) Schematic showing the relationship among Wnt and pgam2, with a limited contribution from retinoic acid (RA).
","imageTitle":"Wnt manipulation affects pgam2 gene expression in zebrafish cardiomyocytes
","methods":"Zebrafish maintenance: All zebrafish husbandry and experiments were performed following protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Florida Gulf Coast University (# 2412000066A002). Adult zebrafish were raised and maintained following standard laboratory conditions and guidelines (Westerfield 2007). All the WT fish used were mixed AB-TL backgrounds. The only transgenic line employed was Tg(-5.1myl7:EGFP) (Huang et al. 2003), whose ZFIN identifier is ZDB-TGCONSTRCT-070117-164. Embryos were raised at 28.5 °C in blue water and staged by hpf.
Pharmacological approach: Each drug treatment was carried out on embryos (20s-48 hpf stages) in 2 mL of blue water with drugs at specific concentrations in 3 mL glass vials (30 embryos/vial). Treated embryos in vials were placed on a nutator in an incubator at 28.5˚C for the duration of the treatments. Drug concentrations were previously indicated (Coppola et al. 2024): 2.5 μM DEAB (Sigma-Aldrich, Cat # D86256), 5 μM BIO (Tocris, Cat # 3194), 10 μM XAV939 (Tocris, Cat # 3748). All the drugs were dissolved in Dimethylsulfoxide (DMSO) (Sigma-Aldrich, Cat # D8418). All the drugs were washed employing blue water 3 times at 48 hpf before heart isolation procedure. Each experiment was performed in triplicate.
Heart isolation: Hearts from untreated (WT) and treated zebrafish at 48 hpf from the Tg(-5.1myl7:EGFP) line were isolated, as previously described (Burns and MacRae 2006; Coppola et al. 2024; DeWildt et al. 2026). ~500 embryos of the aforementioned transgenic line were anesthetized with tricaine and transferred to a sterile 1.5 mL microcentrifuge tube. They were then washed on ice 4 times in cold embryo disruption media (EDM, Gibco Leibovitz’s L-15 Medium, Cat # 11415114) with 10% fetal bovine serum (FBS, Gibco, Cat # 26140079). Embryos were placed in 1.25 mL EDM and triturated for approximately 1 minute using a syringe (1 sec rate) positioned on a ring stand. The fragments were transferred to a 105 μm mesh with 0.5 mL EDM, and immediately to a 40 μm mesh with additional EDM. Finally, the GFP+ hearts were selected utilizing an Olympus SZ51 Stereoscope and placed in clean EDM. The hearts were centrifugated and immediately pelleted at 1300 rpm for 5 minutes. RNA extraction was carried out employing the Single Cell RNA Purification Kit (Norgen Biotek, Cat # 51800). cDNAs were synthetised using iScript™ cDNA Synthesis Kit (Bio-RAD, cat #1708890). RNA was extracted using the same process on three different batches of 120 hearts.
qPCR analyses: experiments were performed as previously described (D’Aniello et al. 2013; Coppola et al. 2024; DeWildt et al. 2026), employing Power SYBR Green PCR Master Mix (Applied Biosystems, Cat # 4368706) in a BioRad CFX-96 PCR machine. Expression levels were normalized against β-actin expression (D’Aniello et al. 2013) and results were analyzed using the Livak 2-ΔΔCT Method (D’Aniello et al. 2013). Each experiment was performed in triplicate. Pgam2 primers were: pgam2fw (AAAACCGTTTCTGCGGCTGG) and pgam2rev (CCATGTTTGGCTGCTGTCTC). The primer efficiency was 103 %. The significance of qPCRs was assessed with an ordinary one-way ANOVA with Dunnett’s correction for experiments with 3 samples (WT vs experimental condition) and Student’s t-test with Welch’s correction with 2 samples. p value <0.05 was considered statistically significant.
Zebrafish emerged as a model for investigating cellular metabolism, with multiple direct implications in the context of metabolic diseases (Benchoula et al. 2019). While recently connected (Iwata and Vanderhaeghen 2024), the relationships existing among developmental pathways and metabolic processes are still very obscure. Intriguingly, Wnt pathway disruptions have been associated with multiple metabolic defects in mammals (Abou Azar and Lim 2021), with mutations in the transcription factor TCF7L2 causing severe metabolic phenotypes in mice (Nguyen-Tu et al. 2021). With respect to the metabolic aspects in cardiac development and disease, zebrafish has been established as a key model for its versatility (Angom and Nakka 2024). Additionally, canonical Wnt signaling represents a fundamental asset in the regulation of zebrafish cardiac development (Ueno et al. 2007), with a conserved role in mammalian models (Liang et al. 2020). Therefore, in light of its key role in the regulation of critical steps in cellular metabolism (Guo et al. 2024), we tested the impact of Wnt signaling on pgam2 (Singh et al. 2023) through an established pharmacological approach (Coppola et al. 2024) in both WT whole-embryo and cardiomyocytes (Figure 1). First, we compared the expression level of pgam2 between WT whole embryos and isolated hearts (Fig. 1A), detecting a moderate increase in cardiomyocytes (CMs). To understand the impact of Wnt signaling on pgam2 during early development, we measured its expression levels in treated embryos with both an activator 6-bromoindirubin-3'-oxime (BIO) and an inhibitor (XAV939) (Fig. 1B). Pgam2 resulted in an increase in BIO-treated samples, while was reduced in XAV939 conditions (Fig. 1B). In order to detect this relationship in CMs, we performed the same treatments on myl7:EGFP transgenic embryos and measured pgam2 expression levels in isolated hearts (Fig. 1C). Intriguingly, the effect of BIO on pgam2 expression in CMs is very strong, with a net increase in comparison with WT whole embryos (Fig. 1B), suggesting a stronger effect of Wnt on this key metabolic gene in the heart. Since retinoic acid (RA) represents a significant pathway in the homeostasis of early vertebrate embryos and their hearts (D’Aniello et al. 2013) and a general regulator of metabolic balance (El Haddad et al. 2017), we tested the RA effect on the Wnt-pgam2 relationship through a functional epistatic approach (Fig. 1D-E). Combining the effect of BIO with the RA inhibitor 4-diethylaminobenzaldehyde (DEAB) in WT whole embryos caused a decrease in pgam2 expression (Fig. 1D). On the other hand, the same epistatic approach caused a reduction of pgam2 expression compared to BIO alone in CMs (Fig. 1E). Intriguingly, the effect of RA inhibition is similar between WT and isolated hearts, suggesting a synergic role of Wnt and RA pathways in the regulation of pgam2 during zebrafish development. Here, we report the first study illustrating the relationship between the Wnt pathway and Pgam2 in zebrafish hearts (Fig. 1F). While the role of Wnt in the metabolic reprogramming in tumors has been already indicated (Koushyar et al. 2022; Tümen et al. 2024), the relationship between Wnt and basic metabolism in zebrafish heart and cardiovascular pathologies has not been clarified. For its well-known versatility as a model system in development and disease (Westerfield 2007) and the recent gain of significance in metabolic studies (Benchoula et al. 2019; Abou Azar and Lim 2021), zebrafish represent a valid target to study metabolic physiological interactions. Through well-established pharmacological manipulations (Coppola et al. 2024; DeWildt et al. 2026), we detected a clear control exerted by Wnt on pgam2 during zebrafish early development. Specifically, we registered higher pgam2 expression in CMs and higher effect of Wnt on gene expression in isolated hearts, suggesting a more relevant effect/control in cardiovascular development. Intriguingly, our epistatic approaches unveiled a contribution of the RA pathway in the relationship existing between Wnt and pgam2 in zebrafish CMs. Our approach suggests a potential RA-Wnt interaction in the control of pgam2 expression in the heart, with Wnt playing a major role in this context (Fig. 1F). Additionally, since Pgam2 has a significant role in the control of the balance between glycolytic pathway and cholesterol metabolism (Guo et al. 2024), our data pave the way to further experiments towards the understanding of Wnt impact of general metabolism in the heart. Furthermore, both the incidence of Wnt defects on mammalian metabolic homeostasis (Abou Azar and Lim 2021) and the implication of TCF7L2 mutations in murine overt metabolic phenotypes (Nguyen-Tu et al. 2021) align with our pharmacological approach. Hence, our data speak in favor of a conserved Wnt involvement in the regulation of a key metabolic gene, Pgam2, in the context of heart development. Intriguingly, human PGAM2 gene has been associated with Glycogen Storage Disease Type X (GSD X) (Tsujino et al. 1993; Hadjigeorgiou et al. 1999; Nayab et al. 2021), which severely affects muscle basic functionalities. Furthermore, BIO activates Wnt signaling through the inhibition of the Glycogen synthase kinase 3 (Gsk3) (Law and Zheng 2022), which is a pivotal element of balance in the cellular metabolism (Wang et al. 2022). On the other hand, XAV939 effectively blocks Wnt signaling interacting with Tankyrases (Wu et al. 2016), which in cancer cells promote aerobic glycolysis (Yang et al. 2019). Thus, it is tempting to speculate a control exerted by Wnt signaling on the basal metabolism in the heart through Pgam2. In cancer cells, both Wnt signaling (Flores-Hernández et al. 2025) and PGAM2 (Gizak et al. 2015; Wang et al. 2025) impact basal metabolism, highlighting a molecular and functional relationship existing in multiple tissues. Furthermore, the Pgam2 overexpression causes cardiac weakness in mice (Okuda et al. 2013) and human PGAM2 resulted in overexpression in patients affected by heart failure (Li et al. 2021), both supporting its involvement in the regulation of basic cardiac development. With respect to PGAM2 implication in cardiac defects, it has been identified as a marker for cardiac ischemia (Li et al. 2012) and associated with cardiac hypertrophy (Li et al. 2025). Additionally, N6-methyladenosine (m6A) post-transcriptional modifications cause glycolytic impairments in the heart of murine obesity models (Zhang et al. 2021). Henceforth, in light of the significance of Pgam2 orthologs in cardiac development/disease and in the balance among distinct metabolic pathways (Guo et al. 2024), future studies will aim to decipher the role of Wnt in regulating genes within specific metabolic pathways (glycolysis, cholesterol, TCA), shedding light on novel Wnt-dependent gene regulatory networks (GRNs) in zebrafish (and vertebrate) hearts.
","references":[{"reference":"Abou Azar F, Lim GE. 2021. Metabolic contributions of Wnt signaling: More than controlling flight. Front. Cell Dev. Biol. 9: 709823.","pubmedId":"","doi":"10.3389/fcell.2021.709823"},{"reference":"Angom RS, Nakka NMR. 2024. Zebrafish as a model for cardiovascular and metabolic disease: The future. Biomedicines. 12: 693.","pubmedId":"","doi":"10.3390/biomedicines12030693"},{"reference":"Benchoula K, Khatib A, Jaffar A, Ahmed QU, Sulaiman WMAW, Wahab RA, El Seedi HR. 2019. The promise of zebrafish as a model of metabolic syndrome. Exp. Anim. 68: 407-416.","pubmedId":"","doi":"10.1538/expanim.18-0168"},{"reference":"Burns CG, Mac Rae CA. 2006. Purification of hearts from zebrafish embryos. Biotechniques. 40: 274, 276, 278 passim.","pubmedId":"","doi":"10.2144/000112135"},{"reference":"Coppola U, Saha B, Kenney J, Waxman JS. 2024. A Foxf1-Wnt-Nr2f1 cascade promotes atrial cardiomyocyte differentiation in. PLoS Genet. 20: e1011222.","pubmedId":"","doi":"10.1371/journal.pgen.1011222"},{"reference":"D Aniello E, Rydeen AB, Anderson JL, Mandal A, Waxman JS. 2013. Depletion of retinoic acid receptors initiates a novel positive feedback. PLoS Genet. 9: e1003689.","pubmedId":"","doi":"10.1371/journal.pgen.1003689"},{"reference":"De Wildt LV, Hildenbrand MA, Manchester CD, Prawiradilaga SI, Ristoratore F, Coppola U. 2026. The unexplored evolutionary history of Nedd genes in metazoans. Front. Ecol. Evol. 14: 1851122.","pubmedId":"","doi":"10.3389/fevo.2026.1851122"},{"reference":"El Haddad M, Notarnicola C, Evano B, El Khatib N, Blaquiere M, Bonnieu A, et al., Carnac G. 2017. Retinoic acid maintains human skeletal muscle progenitor cells in an. Cell. Mol. Life Sci. 74: 1923-1936.","pubmedId":"","doi":"10.1007/s00018-016-2445-1"},{"reference":"Flores Hernandez E, Binder G, Mei KC, Tejeda Munoz N. 2025. Targeting Wnt-driven metabolic adaptations in cancer: integrating. Front. Cell Dev. Biol. 13: 1622218.","pubmedId":"","doi":"10.3389/fcell.2025.1622218"},{"reference":"Gizak A, Grenda M, Mamczur P, Wisniewski J, Sucharski F, Silberring J, et al., Rakus D. 2015. Insulin/IGF1-PI3K-dependent nucleolar localization of a glycolytic enzyme. Oncotarget. 6: 17237-17250.","pubmedId":"","doi":"10.18632/oncotarget.4044"},{"reference":"Guo J, Chen S, Zhang Y, Liu J, Jiang L, Hu L, et al., Chen X. 2024. Cholesterol metabolism: physiological regulation and diseases. MedComm. 5: e476.","pubmedId":"","doi":"10.1002/mco2.476"},{"reference":"Hadjigeorgiou GM, Kawashima N, Bruno C, Andreu AL, Sue CM, Rigden DJ, et al., Di Mauro S. 1999. Manifesting heterozygotes in a Japanese family with a novel mutation in. Neuromuscul. Disord. 9: 399-402.","pubmedId":"","doi":"10.1016/s0960-8966(99)00039-5"},{"reference":"Huang CJ, Tu CT, Hsiao CD, Hsieh FJ, Tsai HJ. 2003. Germ-line transmission of a myocardium-specific GFP transgene reveals. Dev. Dyn. 228: 30-40.","pubmedId":"","doi":"10.1002/dvdy.10356"},{"reference":"Iwata R, Vanderhaeghen P. 2024. Metabolic mechanisms of species-specific developmental tempo. Dev. Cell. 59: 1628-1639.","pubmedId":"","doi":"10.1016/j.devcel.2024.05.027"},{"reference":"Koushyar S, Meniel VS, Phesse TJ, Pearson HB. 2022. Exploring the Wnt pathway as a therapeutic target for prostate cancer. Biomolecules. 12: 309.","pubmedId":"","doi":"10.3390/biom12020309"},{"reference":"Law SM, Zheng JJ. 2022. Premise and peril of Wnt signaling activation through GSK-3β inhibition. iScience. 25: 104159.","pubmedId":"","doi":"10.1016/j.isci.2022.104159"},{"reference":"Li H, Li J, Wang Y, Yang T. 2012. Proteomic analysis of effluents from perfused human heart for. Proteome Sci. 10: 21.","pubmedId":"","doi":"10.1186/1477-5956-10-21"},{"reference":"Li M, Gao X, Wang H, Zhang M, Li X, Wang S, et al., Su G. 2021. Phosphoglycerate mutase 2 is elevated in serum of patients with heart. Open Med. (Warsz.). 16: 1134-1142.","pubmedId":"","doi":"10.1515/med-2021-0324"},{"reference":"Li Y, Li WJ, Du JM, Wu HH, Zhou SY, Li M, et al., Su GH. 2025. Downregulation of PGAM2 alleviates angiotensin II-induced cardiac. Int. J. Biol. Sci. 21: 1308-1321.","pubmedId":"","doi":"10.7150/ijbs.102251"},{"reference":"Liang W, Han P, Kim EH, Mak J, Zhang R, Torrente AG, et al., Cho HC. 2020. Canonical Wnt signaling promotes pacemaker cell specification of cardiac. Stem Cells. 38: 352-368.","pubmedId":"","doi":"10.1002/stem.3106"},{"reference":"Nayab A, Alam Q, Alzahrani OR, Khan R, Sarfaraz S, Albaz AA, et al., Umair M. 2021. Targeted exome sequencing identified a novel frameshift variant in the. Eur. J. Med. Genet. 64: 104283.","pubmedId":"","doi":"10.1016/j.ejmg.2021.104283"},{"reference":"Nguyen Tu MS, Martinez Sanchez A, Leclerc I, Rutter GA, Da Silva Xavier G. 2021. Adipocyte-specific deletion of Tcf7l2 induces dysregulated lipid. Diabetologia. 64: 129-141.","pubmedId":"","doi":"10.1007/s00125-020-05292-4"},{"reference":"Okuda J, Niizuma S, Shioi T, Kato T, Inuzuka Y, Kawashima T, et al., Kimura T. 2013. Persistent overexpression of phosphoglycerate mutase, a glycolytic enzyme,. PLoS One. 8: e72173.","pubmedId":"","doi":"10.1371/journal.pone.0072173"},{"reference":"Singh MK, Yadav R, Bhaskar AK, Sengupta S, Sachidanandan C. 2023. A diet-independent zebrafish model for NAFLD recapitulates patient lipid. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 1868: 159246.","pubmedId":"","doi":"10.1016/j.bbalip.2022.159246"},{"reference":"Tsujino S, Shanske S, Sakoda S, Fenichel G, Di Mauro S. 1993. The molecular genetic basis of muscle phosphoglycerate mutase (PGAM). Am. J. Hum. Genet. 52: 472-477.","pubmedId":"","doi":""},{"reference":"Tumen D, Heumann P, Huber J, Hahn N, Macek C, Ernst M, et al., Gulow K. 2024. Unraveling cancer’s Wnt signaling: Dynamic control through protein kinase. Cancers (Basel). 16: 2686.","pubmedId":"","doi":"10.3390/cancers16152686"},{"reference":"Ueno S, Weidinger G, Osugi T, Kohn AD, Golob JL, Pabon L, et al., Murry CE. 2007. Biphasic role for Wnt/β-catenin signaling in cardiac specification in. Proceedings of the National Academy of Sciences. 104: 9685-9690.","pubmedId":"","doi":"10.1073/pnas.0702859104"},{"reference":"Wang L, Li J, Di LJ. 2022. Glycogen synthesis and beyond, a comprehensive review of GSK3 as a key. Med. Res. Rev. 42: 946-982.","pubmedId":"","doi":"10.1002/med.21867"},{"reference":"Wang Z, Guo Y, Hu K, He T, Qin T, Zhang L, et al., Zhao Q. 2025. Hepatocellular carcinoma cells downregulate PGAM2 via SIRT2-mediated. NPJ Precis. Oncol. 9","pubmedId":"","doi":"10.1038/s41698-025-00930-9"},{"reference":"Westerfield M. 2007. The Zebrafish Book; A guide for the laboratory use of zebrafish (Danio. (No Title)","pubmedId":"","doi":""},{"reference":"Wu X, Luo F, Li J, Zhong X, Liu K. 2016. Tankyrase 1 inhibitior XAV939 increases chemosensitivity in colon cancer. Int. J. Oncol. 48: 1333-1340.","pubmedId":"","doi":"10.3892/ijo.2016.3360"},{"reference":"Yang HY, Shen JX, Wang Y, Liu Y, Shen DY, Quan S. 2019. Tankyrase promotes aerobic glycolysis and proliferation of ovarian cancer. Biomed Res. Int. 2019: 1-14.","pubmedId":"","doi":"10.1155/2019/2686340"},{"reference":"Zhang B, Jiang H, Wu J, Cai Y, Dong Z, Zhao Y, et al., Ge J. 2021. m6A demethylase FTO attenuates cardiac dysfunction by regulating glucose. Signal Transduct. Target. Ther. 6: 377.","pubmedId":"","doi":"10.1038/s41392-021-00699-w"}],"title":"Pilot: Wnt signaling controls pgam2 expression in zebrafish cardiomyocytes
","reviews":[{"reviewer":{"displayName":"Raffaella De Paolo"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":"1785859106629"}]},{"id":"fdf8df98-3e98-4f83-9457-764609b2718e","decision":"edit","abstract":"The relationship between developmental signaling pathways and basal metabolism in zebrafish hearts is still unexplored. Given the key role of canonical Wnt signaling in zebrafish cardiac development, our study analyzes the responsiveness to Wnt of phosphoglycerate mutase 2 (pgam2), which catalyzes the glycolytic conversion of 3-phosphoglycerate to 2-phosphoglycerate. Notably, Pgam2 emerged as a gateway between glycolytic and cholesterol metabolism for its intersection with ATP generation within the cell. Since Pgam2 is linked to overall metabolic homeostasis and multiple cardiovascular diseases (CVDs), it represents a perfect candidate to dissect the Wnt involvement in the basic metabolism of developing cardiomyocytes.
","acknowledgements":"We thank Dr Sherri Emer, Dr Lyndsay Rhodes and Lea Ann Panek for their help. We thank Dr Elena Albizzati for her suggestions in manuscript preparation.
","authors":[{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Department of Biological Sciences"],"credit":["formalAnalysis","methodology","investigation"],"email":"mahildenbrand0876@eagle.fgcu.edu","firstName":"Madisyn A.","lastName":"Hildenbrand","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States","University of South Carolina, Columbia, SC, United States"],"departments":["Department of Biological Sciences","Department of Biological Sciences"],"credit":["methodology","investigation"],"email":"klako7420@eagle.fgcu.edu","firstName":"Klejdi ","lastName":"Lako","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Department of Biological Sciences"],"credit":["conceptualization","investigation","fundingAcquisition","resources","supervision","dataCuration","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"ucoppola@fgcu.edu","firstName":"Ugo","lastName":"Coppola","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8479-2401"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by Florida Gulf Coast University (FGCU) startup funds (PI: Ugo Coppola).
A) Differential expression of pgam2 gene in WT whole embryos vs WT isolated hearts at 48 hpf. B) Effects of BIO/XAV939 treatments on pgam2 expression in WT whole embryos at 48 hpf. C) Effects of BIO/XAV939 treatments on pgam2 expression in isolated hearts at 48 hpf. D) Combined effect of BIO and DEAB treatment on pgam2 expression in WT whole embryos at 48 hpf. E) Combined effect of BIO and DEAB treatment on pgam2 expression in isolated hearts at 48 hpf. Fold difference is relative to β-actin. Error bars in the graph indicate s.e.m. * indicates P < 0.05, ** indicates P < 0.01, **** indicates P < 0.0001. E) Schematic showing the relationship between Wnt and pgam2, with a limited contribution from retinoic acid (RA).
","imageTitle":"Wnt pathway regulates pgam2 gene expression in zebrafish cardiomyocytes
","methods":"Zebrafish maintenance: All zebrafish husbandry and experiments were performed following protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Florida Gulf Coast University (# 2412000066A002). Adult zebrafish were raised and maintained following standard laboratory conditions and guidelines (Westerfield 2007). All the WT fish used were mixed AB-TL backgrounds. The only transgenic line employed was Tg(-5.1myl7: EGFP, twu34Tg) (Huang et al. 2003), whose ZFIN identifier is ZDB-TGCONSTRCT-070117-164. Embryos were raised at 28.5 °C in blue water and staged by hpf.
Pharmacological approach: Each drug treatment was carried out on embryos (20s-48 hpf stages) in 2 mL of blue water with drugs at specific concentrations in 3 mL glass vials (30 embryos/vial). Control and treated embryos were placed in vials on a nutator positioned in an incubator at 28.5˚C for the duration of the treatments. Drug concentrations were previously indicated (Coppola et al. 2024): 2.5 μM DEAB (Sigma-Aldrich, Cat # D86256), 5 μM BIO (Tocris, Cat # 3194), 10 μM XAV939 (Tocris, Cat # 3748). All the drugs were dissolved in Dimethylsulfoxide (DMSO) (Sigma-Aldrich, Cat # D8418). All the drugs were washed employing blue water 3 times at 48 hpf before heart isolation procedure. Each experiment was performed in triplicate.
Heart isolation: The hearts from untreated (WT) and treated zebrafish at 48 hpf from the Tg(-5.1myl7: EGFP) line were isolated as previously described (Burns and MacRae 2006; Coppola et al. 2024; DeWildt et al. 2026). ~500 embryos of the aforementioned transgenic line were anesthetized with tricaine and transferred to a sterile 1.5 mL microcentrifuge tube. They were then washed on ice 4 times in cold embryo disruption media (EDM, Gibco Leibovitz’s L-15 Medium, Cat # 11415114) with 10% fetal bovine serum (FBS, Gibco, Cat # 26140079). Embryos were placed in 1.25 mL EDM and triturated for approximately 1 minute using a syringe (1 sec rate) positioned on a ring stand. The fragments were transferred to a 105 μm mesh with 0.5 mL EDM, and immediately to a 40 μm mesh with additional EDM. Finally, the GFP+ hearts were selected utilizing an Olympus SZ51 Stereoscope and placed in clean EDM. The hearts were centrifugated and immediately pelleted at 1300 rpm for 5 minutes. RNA extraction was carried out employing the Single Cell RNA Purification Kit (Norgen Biotek, Cat # 51800). cDNAs were synthetised using iScript™ cDNA Synthesis Kit (Bio-RAD, cat #1708890). RNA was extracted using the same process on three different batches of 120 hearts.
qPCR analyses: experiments were performed as previously described (D’Aniello et al. 2013; Coppola et al. 2024; DeWildt et al. 2026), employing Power SYBR Green PCR Master Mix (Applied Biosystems, Cat # 4368706) in a BioRad CFX-96 PCR machine. Expression levels were normalized against β-actin expression (D’Aniello et al. 2013) and results were analyzed using the Livak 2-ΔΔCT Method (D’Aniello et al. 2013). Each experiment was performed in triplicate. Pgam2 primers were: pgam2fw (AAAACCGTTTCTGCGGCTGG) and pgam2rev (CCATGTTTGGCTGCTGTCTC). The primer efficiency was 103 %. The significance of qPCRs was assessed with an ordinary one-way ANOVA with Dunnett’s correction for experiments with 3 samples (WT vs experimental condition) and Student’s t-test with Welch’s correction with 2 samples. p value <0.05 was considered statistically significant.
Zebrafish emerged as a model for the investigation of cellular metabolism, with multiple direct implications in the context of metabolic diseases (Benchoula et al. 2019). While recently connected (Iwata and Vanderhaeghen 2024), the relationships existing between developmental pathways and metabolic processes are still very obscure. Intriguingly, Wnt pathway disruptions have been associated with multiple metabolic defects in mammals (Abou Azar and Lim 2021), while mutations in the transcription factor TCF7L2 cause severe metabolic phenotypes in mice (Nguyen-Tu et al. 2021). With respect to the metabolic aspects in cardiac development and disease, zebrafish has been indicated as a key model for its versatility (Angom and Nakka 2024). Additionally, canonical Wnt signaling represents a fundamental asset in the regulation of zebrafish cardiac development (Ueno et al. 2007), with a conserved role in mammalian models (Liang et al. 2020). Therefore, in light of its key role in the regulation of critical steps in cellular metabolism (Guo et al. 2024), we tested the impact of Wnt signaling on pgam2 (Singh et al. 2023) through an established pharmacological approach (Coppola et al. 2024) in both WT whole-embryos and cardiomyocytes (Figure 1). First, we compared the expression level of pgam2 between whole embryos and isolated hearts from WT samples at 48 hpf (Fig. 1A), detecting a moderate pgam2 increase in cardiomyocytes (CMs). To understand the impact of Wnt signaling on pgam2 during early development, we measured its expression levels in embryos treated with both a Wnt activator (6-bromoindirubin-3'-oxime, BIO) and a Wnt inhibitor (3,5,7,8-tetrahydro-2-[4-(trifluoromethyl)phenyl]-4H-thiopyrano[4, 3-d]pyrimidin-4-one, XAV939) (Fig. 1B). Pgam2 resulted in an increase in BIO-treated samples, while was reduced with the XAV939 treatment (Fig. 1B). In order to analyze this relationship in CMs, we performed the same treatments on myl7: EGFP transgenic embryos and measured pgam2 expression levels in isolated hearts (Fig. 1C). Intriguingly, the effect of BIO on pgam2 expression in CMs is very strong, with a net increase in comparison with WT whole embryos (Fig. 1B), suggesting a stronger effect of Wnt on this key metabolic gene in the heart. Since retinoic acid (RA) represents a significant pathway in the homeostasis of early vertebrate embryos and their hearts (D’Aniello et al. 2013) and a general regulator of metabolic balance (El Haddad et al. 2017), we tested the RA effect on the Wnt-pgam2 relationship through a functional epistatic approach (Fig. 1D-E). Combining the effect of BIO with the RA inhibitor 4-diethylaminobenzaldehyde (DEAB) in WT whole embryos caused a reduction in pgam2 expression (Fig. 1D). On the other hand, the same epistatic approach caused a decrease of pgam2 expression (Fig. 1E) when compared to BIO alone in CMs (Fig. 1C). Intriguingly, the effect of RA inhibition is similar between WT and isolated hearts, suggesting a synergic role of Wnt and RA pathways in the regulation of pgam2 during zebrafish development. Here, we report the first study illustrating the relationship between the Wnt pathway and Pgam2 in zebrafish hearts (Fig. 1F). While the role of Wnt in the metabolic reprogramming in tumors has been already indicated (Koushyar et al. 2022; Tümen et al. 2024), the relationship between Wnt and basic metabolism in zebrafish heart and cardiovascular pathologies has not been clarified. For its well-known versatility as a model system in development and disease (Westerfield 2007) and the recent gain of significance in metabolic studies (Benchoula et al. 2019; Abou Azar and Lim 2021), zebrafish represent a valid target to study metabolic physiological interactions. Through well-established pharmacological manipulations (Coppola et al. 2024; DeWildt et al. 2026), we highlighted a clear control exerted by Wnt on pgam2 during zebrafish early development. Specifically, we registered higher pgam2 expression in CMs and higher effect of Wnt on gene expression in isolated hearts, suggesting a more relevant effect/control in cardiovascular development. Intriguingly, our epistatic approaches unveiled a contribution of the RA pathway in the relationship existing between Wnt and pgam2 in zebrafish CMs, suggesting a potential RA-Wnt interaction in the control of pgam2 expression in the heart, with Wnt playing a major role in this context (Fig. 1F). Additionally, since Pgam2 has a significant role in the control of the balance between glycolytic pathway and cholesterol metabolism (Guo et al. 2024), our findings pave the way to further experiments towards the understanding of Wnt impact of general metabolism in the heart. Furthermore, both the incidence of Wnt defects on mammalian metabolic homeostasis (Abou Azar and Lim 2021) and the implication of TCF7L2 mutations in murine overt metabolic phenotypes (Nguyen-Tu et al. 2021) align with our pharmacological approach. Hence, our zebrafish data speak in favor of a conserved Wnt involvement in the regulation of a key metabolic gene, Pgam2, in the context of heart development. Intriguingly, human PGAM2 gene has been associated with Glycogen Storage Disease Type X (GSD X) (Tsujino et al. 1993; Hadjigeorgiou et al. 1999; Nayab et al. 2021), which severely affects muscle basic functionalities. Furthermore, BIO activates Wnt signaling through the inhibition of the Glycogen synthase kinase 3 (Gsk3) (Law and Zheng 2022), which is a pivotal element of balance in the cellular metabolism (Wang et al. 2022). On the other hand, XAV939 effectively blocks Wnt signaling interacting with Tankyrases (Wu et al. 2016), which in cancer cells promote aerobic glycolysis (Yang et al. 2019). Thus, it is tempting to speculate a control exerted by Wnt signaling on the basal metabolism in the heart through Pgam2. In cancer cells, both Wnt signaling (Flores-Hernández et al. 2025) and PGAM2 (Gizak et al. 2015; Wang et al. 2025) impact basal metabolism, highlighting a molecular and functional relationship existing in multiple tissues. Furthermore, the Pgam2 overexpression causes cardiac weakness in mice (Okuda et al. 2013) and PGAM2 resulted in overexpression in patients affected by heart failure (Li et al. 2021), both supporting its involvement in the regulation of basic cardiac development. With respect to PGAM2 implication in cardiac defects, it has been identified as a marker for cardiac ischemia (Li et al. 2012) and associated with cardiac hypertrophy (Li et al. 2025). Additionally, N6-methyladenosine (m6A) post-transcriptional modifications cause glycolytic impairments in the heart of murine obesity models (Zhang et al. 2021). Henceforth, in light of the significance of Pgam2 orthologs in cardiac development and disease and for its strategic position among distinct metabolic pathways (Guo et al. 2024), future studies will aim to completely decipher the role of Wnt in regulating pgam2 and other genes within specific metabolic pathways (glycolysis, cholesterol, TCA), shedding light on novel Wnt-dependent gene regulatory networks (GRNs) in zebrafish (and vertebrate) hearts.
","references":[{"reference":"Abou Azar F, Lim GE. 2021. Metabolic contributions of Wnt signaling: More than controlling flight. Front. Cell Dev. Biol. 9: 709823.","pubmedId":"","doi":"10.3389/fcell.2021.709823"},{"reference":"Angom RS, Nakka NMR. 2024. Zebrafish as a model for cardiovascular and metabolic disease: The future. Biomedicines. 12: 693.","pubmedId":"","doi":"10.3390/biomedicines12030693"},{"reference":"Benchoula K, Khatib A, Jaffar A, Ahmed QU, Sulaiman WMAW, Wahab RA, El Seedi HR. 2019. The promise of zebrafish as a model of metabolic syndrome. Exp. Anim. 68: 407-416.","pubmedId":"","doi":"10.1538/expanim.18-0168"},{"reference":"Burns CG, Mac Rae CA. 2006. Purification of hearts from zebrafish embryos. Biotechniques. 40: 274, 276, 278 passim.","pubmedId":"","doi":"10.2144/000112135"},{"reference":"Coppola U, Saha B, Kenney J, Waxman JS. 2024. A Foxf1-Wnt-Nr2f1 cascade promotes atrial cardiomyocyte differentiation in. PLoS Genet. 20: e1011222.","pubmedId":"","doi":"10.1371/journal.pgen.1011222"},{"reference":"D Aniello E, Rydeen AB, Anderson JL, Mandal A, Waxman JS. 2013. Depletion of retinoic acid receptors initiates a novel positive feedback. PLoS Genet. 9: e1003689.","pubmedId":"","doi":"10.1371/journal.pgen.1003689"},{"reference":"De Wildt LV, Hildenbrand MA, Manchester CD, Prawiradilaga SI, Ristoratore F, Coppola U. 2026. The unexplored evolutionary history of Nedd genes in metazoans. Front. Ecol. Evol. 14: 1851122.","pubmedId":"","doi":"10.3389/fevo.2026.1851122"},{"reference":"El Haddad M, Notarnicola C, Evano B, El Khatib N, Blaquiere M, Bonnieu A, et al., Carnac G. 2017. Retinoic acid maintains human skeletal muscle progenitor cells in an. Cell. Mol. Life Sci. 74: 1923-1936.","pubmedId":"","doi":"10.1007/s00018-016-2445-1"},{"reference":"Flores Hernandez E, Binder G, Mei KC, Tejeda Munoz N. 2025. Targeting Wnt-driven metabolic adaptations in cancer: integrating. Front. Cell Dev. Biol. 13: 1622218.","pubmedId":"","doi":"10.3389/fcell.2025.1622218"},{"reference":"Gizak A, Grenda M, Mamczur P, Wisniewski J, Sucharski F, Silberring J, et al., Rakus D. 2015. Insulin/IGF1-PI3K-dependent nucleolar localization of a glycolytic enzyme. Oncotarget. 6: 17237-17250.","pubmedId":"","doi":"10.18632/oncotarget.4044"},{"reference":"Guo J, Chen S, Zhang Y, Liu J, Jiang L, Hu L, et al., Chen X. 2024. Cholesterol metabolism: physiological regulation and diseases. MedComm. 5: e476.","pubmedId":"","doi":"10.1002/mco2.476"},{"reference":"Hadjigeorgiou GM, Kawashima N, Bruno C, Andreu AL, Sue CM, Rigden DJ, et al., Di Mauro S. 1999. Manifesting heterozygotes in a Japanese family with a novel mutation in. Neuromuscul. Disord. 9: 399-402.","pubmedId":"","doi":"10.1016/s0960-8966(99)00039-5"},{"reference":"Huang CJ, Tu CT, Hsiao CD, Hsieh FJ, Tsai HJ. 2003. Germ-line transmission of a myocardium-specific GFP transgene reveals. Dev. Dyn. 228: 30-40.","pubmedId":"","doi":"10.1002/dvdy.10356"},{"reference":"Iwata R, Vanderhaeghen P. 2024. Metabolic mechanisms of species-specific developmental tempo. Dev. Cell. 59: 1628-1639.","pubmedId":"","doi":"10.1016/j.devcel.2024.05.027"},{"reference":"Koushyar S, Meniel VS, Phesse TJ, Pearson HB. 2022. Exploring the Wnt pathway as a therapeutic target for prostate cancer. Biomolecules. 12: 309.","pubmedId":"","doi":"10.3390/biom12020309"},{"reference":"Law SM, Zheng JJ. 2022. Premise and peril of Wnt signaling activation through GSK-3β inhibition. iScience. 25: 104159.","pubmedId":"","doi":"10.1016/j.isci.2022.104159"},{"reference":"Li H, Li J, Wang Y, Yang T. 2012. Proteomic analysis of effluents from perfused human heart for. Proteome Sci. 10: 21.","pubmedId":"","doi":"10.1186/1477-5956-10-21"},{"reference":"Li M, Gao X, Wang H, Zhang M, Li X, Wang S, et al., Su G. 2021. Phosphoglycerate mutase 2 is elevated in serum of patients with heart. Open Med. (Warsz.). 16: 1134-1142.","pubmedId":"","doi":"10.1515/med-2021-0324"},{"reference":"Li Y, Li WJ, Du JM, Wu HH, Zhou SY, Li M, et al., Su GH. 2025. Downregulation of PGAM2 alleviates angiotensin II-induced cardiac. Int. J. Biol. Sci. 21: 1308-1321.","pubmedId":"","doi":"10.7150/ijbs.102251"},{"reference":"Liang W, Han P, Kim EH, Mak J, Zhang R, Torrente AG, et al., Cho HC. 2020. Canonical Wnt signaling promotes pacemaker cell specification of cardiac. Stem Cells. 38: 352-368.","pubmedId":"","doi":"10.1002/stem.3106"},{"reference":"Nayab A, Alam Q, Alzahrani OR, Khan R, Sarfaraz S, Albaz AA, et al., Umair M. 2021. Targeted exome sequencing identified a novel frameshift variant in the. Eur. J. Med. Genet. 64: 104283.","pubmedId":"","doi":"10.1016/j.ejmg.2021.104283"},{"reference":"Nguyen Tu MS, Martinez Sanchez A, Leclerc I, Rutter GA, Da Silva Xavier G. 2021. Adipocyte-specific deletion of Tcf7l2 induces dysregulated lipid. Diabetologia. 64: 129-141.","pubmedId":"","doi":"10.1007/s00125-020-05292-4"},{"reference":"Okuda J, Niizuma S, Shioi T, Kato T, Inuzuka Y, Kawashima T, et al., Kimura T. 2013. Persistent overexpression of phosphoglycerate mutase, a glycolytic enzyme,. PLoS One. 8: e72173.","pubmedId":"","doi":"10.1371/journal.pone.0072173"},{"reference":"Singh MK, Yadav R, Bhaskar AK, Sengupta S, Sachidanandan C. 2023. A diet-independent zebrafish model for NAFLD recapitulates patient lipid. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 1868: 159246.","pubmedId":"","doi":"10.1016/j.bbalip.2022.159246"},{"reference":"Tsujino S, Shanske S, Sakoda S, Fenichel G, Di Mauro S. 1993. The molecular genetic basis of muscle phosphoglycerate mutase (PGAM). Am. J. Hum. Genet. 52: 472-477.","pubmedId":"","doi":""},{"reference":"Tumen D, Heumann P, Huber J, Hahn N, Macek C, Ernst M, et al., Gulow K. 2024. Unraveling cancer’s Wnt signaling: Dynamic control through protein kinase. Cancers (Basel). 16: 2686.","pubmedId":"","doi":"10.3390/cancers16152686"},{"reference":"Ueno S, Weidinger G, Osugi T, Kohn AD, Golob JL, Pabon L, et al., Murry CE. 2007. Biphasic role for Wnt/β-catenin signaling in cardiac specification in. Proceedings of the National Academy of Sciences. 104: 9685-9690.","pubmedId":"","doi":"10.1073/pnas.0702859104"},{"reference":"Wang L, Li J, Di LJ. 2022. Glycogen synthesis and beyond, a comprehensive review of GSK3 as a key. Med. Res. Rev. 42: 946-982.","pubmedId":"","doi":"10.1002/med.21867"},{"reference":"Wang Z, Guo Y, Hu K, He T, Qin T, Zhang L, et al., Zhao Q. 2025. Hepatocellular carcinoma cells downregulate PGAM2 via SIRT2-mediated. NPJ Precis. Oncol. 9","pubmedId":"","doi":"10.1038/s41698-025-00930-9"},{"reference":"Westerfield M. 2007. The Zebrafish Book; A guide for the laboratory use of zebrafish (Danio. (No Title)","pubmedId":"","doi":""},{"reference":"Wu X, Luo F, Li J, Zhong X, Liu K. 2016. Tankyrase 1 inhibitior XAV939 increases chemosensitivity in colon cancer. Int. J. Oncol. 48: 1333-1340.","pubmedId":"","doi":"10.3892/ijo.2016.3360"},{"reference":"Yang HY, Shen JX, Wang Y, Liu Y, Shen DY, Quan S. 2019. Tankyrase promotes aerobic glycolysis and proliferation of ovarian cancer. Biomed Res. Int. 2019: 1-14.","pubmedId":"","doi":"10.1155/2019/2686340"},{"reference":"Zhang B, Jiang H, Wu J, Cai Y, Dong Z, Zhao Y, et al., Ge J. 2021. m6A demethylase FTO attenuates cardiac dysfunction by regulating glucose. Signal Transduct. Target. Ther. 6: 377.","pubmedId":"","doi":"10.1038/s41392-021-00699-w"}],"title":"Pilot: Wnt signaling controls pgam2 expression in zebrafish cardiomyocytes
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]},{"id":"77abb87c-d6b1-4720-ab30-5c26a33cc4e1","decision":"publish","abstract":"The relationship between developmental signaling pathways and basal metabolism in zebrafish hearts is still unexplored. Given the key role of canonical Wnt signaling in zebrafish cardiac development, our study analyzes the responsiveness to Wnt of phosphoglycerate mutase 2 (pgam2), which catalyzes the glycolytic conversion of 3-phosphoglycerate to 2-phosphoglycerate. Notably, Pgam2 emerged as a gateway between glycolytic and cholesterol metabolism for its intersection with ATP generation within the cell. Since Pgam2 is linked to overall metabolic homeostasis and multiple cardiovascular diseases (CVDs), it represents a perfect candidate to dissect the Wnt involvement in the basic metabolism of developing cardiomyocytes.
","acknowledgements":"We thank Dr Sherri Emer, Dr Lyndsay Rhodes and Lea Ann Panek for their help. We thank Dr Elena Albizzati for her suggestions in manuscript preparation.
","authors":[{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Department of Biological Sciences"],"credit":["formalAnalysis","methodology","investigation"],"email":"mahildenbrand0876@eagle.fgcu.edu","firstName":"Madisyn A.","lastName":"Hildenbrand","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States","University of South Carolina, Columbia, SC, United States"],"departments":["Department of Biological Sciences","Department of Biological Sciences"],"credit":["methodology","investigation"],"email":"klako7420@eagle.fgcu.edu","firstName":"Klejdi ","lastName":"Lako","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Florida Gulf Coast University, Fort Myers, FL, United States"],"departments":["Department of Biological Sciences"],"credit":["conceptualization","investigation","fundingAcquisition","resources","supervision","dataCuration","formalAnalysis","writing_originalDraft","writing_reviewEditing"],"email":"ucoppola@fgcu.edu","firstName":"Ugo","lastName":"Coppola","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-8479-2401"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by Florida Gulf Coast University (FGCU) startup funds (PI: Ugo Coppola).
A) Differential expression of pgam2 gene in WT whole embryos vs WT isolated hearts at 48 hpf. B) Effects of BIO/XAV939 treatments on pgam2 expression in WT whole embryos at 48 hpf. C) Effects of BIO/XAV939 treatments on pgam2 expression in isolated hearts at 48 hpf. D) Combined effect of BIO and DEAB treatment on pgam2 expression in WT whole embryos at 48 hpf. E) Combined effect of BIO and DEAB treatment on pgam2 expression in isolated hearts at 48 hpf. Fold difference is relative to β-actin. Error bars in the graph indicate s.e.m. * indicates P < 0.05, ** indicates P < 0.01, **** indicates P < 0.0001. F) Schematic showing the relationship between Wnt and pgam2, with a limited contribution from retinoic acid (RA).
","imageTitle":"Wnt pathway regulates pgam2 gene expression in zebrafish cardiomyocytes
","methods":"Zebrafish maintenance: All zebrafish husbandry and experiments were performed following protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Florida Gulf Coast University (# 2412000066A002). Adult zebrafish were raised and maintained following standard laboratory conditions and guidelines (Westerfield 2007). All the WT fish used were mixed AB-TL backgrounds. The only transgenic line employed was Tg(-5.1myl7: EGFP, twu34Tg) (Huang et al. 2003), whose ZFIN identifier is ZDB-TGCONSTRCT-070117-164. Embryos were raised at 28.5 °C in blue water and staged by hpf.
Pharmacological approach: Each drug treatment was carried out on embryos (20s-48 hpf stages) in 2 mL of blue water with drugs at specific concentrations in 3 mL glass vials (30 embryos/vial). Control and treated embryos were placed in vials on a nutator positioned in an incubator at 28.5˚C for the duration of the treatments. Drug concentrations were previously indicated (Coppola et al. 2024): 2.5 μM DEAB (Sigma-Aldrich, Cat # D86256), 5 μM BIO (Tocris, Cat # 3194), 10 μM XAV939 (Tocris, Cat # 3748). All the drugs were dissolved in Dimethylsulfoxide (DMSO) (Sigma-Aldrich, Cat # D8418). All the drugs were washed employing blue water 3 times at 48 hpf before heart isolation procedure. Each experiment was performed in triplicate.
Heart isolation: The hearts from untreated (WT) and treated zebrafish at 48 hpf from the Tg(-5.1myl7: EGFP) line were isolated as previously described (Burns and MacRae 2006; Coppola et al. 2024; DeWildt et al. 2026). ~500 embryos of the aforementioned transgenic line were anesthetized with tricaine and transferred to a sterile 1.5 mL microcentrifuge tube. They were then washed on ice 4 times in cold embryo disruption media (EDM, Gibco Leibovitz’s L-15 Medium, Cat # 11415114) with 10% fetal bovine serum (FBS, Gibco, Cat # 26140079). Embryos were placed in 1.25 mL EDM and triturated for approximately 1 minute using a syringe (1 sec rate) positioned on a ring stand. The fragments were transferred to a 105 μm mesh with 0.5 mL EDM, and immediately to a 40 μm mesh with additional EDM. Finally, the GFP+ hearts were selected utilizing an Olympus SZ51 Stereoscope and placed in clean EDM. The hearts were centrifugated and immediately pelleted at 1300 rpm for 5 minutes. RNA extraction was carried out employing the Single Cell RNA Purification Kit (Norgen Biotek, Cat # 51800). cDNAs were synthetised using iScript™ cDNA Synthesis Kit (Bio-RAD, cat #1708890). RNA was extracted using the same process on three different batches of 120 hearts.
qPCR analyses: experiments were performed as previously described (D’Aniello et al. 2013; Coppola et al. 2024; DeWildt et al. 2026), employing Power SYBR Green PCR Master Mix (Applied Biosystems, Cat # 4368706) in a BioRad CFX-96 PCR machine. Expression levels were normalized against β-actin expression (D’Aniello et al. 2013) and results were analyzed using the Livak 2-ΔΔCT Method (D’Aniello et al. 2013). Each experiment was performed in triplicate. Pgam2 primers were: pgam2fw (AAAACCGTTTCTGCGGCTGG) and pgam2rev (CCATGTTTGGCTGCTGTCTC). The primer efficiency was 103 %. The significance of qPCRs was assessed with an ordinary one-way ANOVA with Dunnett’s correction for experiments with 3 samples (WT vs experimental condition) and Student’s t-test with Welch’s correction with 2 samples. p value <0.05 was considered statistically significant.
Zebrafish emerged as a model for the investigation of cellular metabolism, with multiple direct implications in the context of metabolic diseases (Benchoula et al. 2019). While recently connected (Iwata and Vanderhaeghen 2024), the relationships existing between developmental pathways and metabolic processes are still very obscure. Intriguingly, Wnt pathway disruptions have been associated with multiple metabolic defects in mammals (Abou Azar and Lim 2021), while mutations in the transcription factor TCF7L2 cause severe metabolic phenotypes in mice (Nguyen-Tu et al. 2021). With respect to the metabolic aspects in cardiac development and disease, zebrafish has been indicated as a key model for its versatility (Angom and Nakka 2024). Additionally, canonical Wnt signaling represents a fundamental asset in the regulation of zebrafish cardiac development (Ueno et al. 2007), with a conserved role in mammalian models (Liang et al. 2020). Therefore, in light of its key role in the regulation of critical steps in cellular metabolism (Guo et al. 2024), we tested the impact of Wnt signaling on pgam2 (Singh et al. 2023) through an established pharmacological approach (Coppola et al. 2024) in both WT whole-embryos and cardiomyocytes (Figure 1). First, we compared the expression level of pgam2 between whole embryos and isolated hearts from WT samples at 48 hpf (Fig. 1A), detecting a moderate pgam2 increase in cardiomyocytes (CMs). To understand the impact of Wnt signaling on pgam2 during early development, we measured its expression levels in embryos treated with both a Wnt activator (6-bromoindirubin-3'-oxime, BIO) and a Wnt inhibitor (3,5,7,8-tetrahydro-2-[4-(trifluoromethyl)phenyl]-4H-thiopyrano[4, 3-d]pyrimidin-4-one, XAV939) (Fig. 1B). Pgam2 resulted in an increase in BIO-treated samples, while was reduced with the XAV939 treatment (Fig. 1B). In order to analyze this relationship in CMs, we performed the same treatments on myl7: EGFP transgenic embryos and measured pgam2 expression levels in isolated hearts (Fig. 1C). Intriguingly, the effect of BIO on pgam2 expression in CMs is very strong, with a net increase in comparison with WT whole embryos (Fig. 1B), suggesting a stronger effect of Wnt on this key metabolic gene in the heart. Since retinoic acid (RA) represents a significant pathway in the homeostasis of early vertebrate embryos and their hearts (D’Aniello et al. 2013) and a general regulator of metabolic balance (El Haddad et al. 2017), we tested the RA effect on the Wnt-pgam2 relationship through a functional epistatic approach (Fig. 1D-E). Combining the effect of BIO with the RA inhibitor 4-diethylaminobenzaldehyde (DEAB) in WT whole embryos caused a reduction in pgam2 expression (Fig. 1D). On the other hand, the same epistatic approach caused a decrease of pgam2 expression (Fig. 1E) when compared to BIO alone in CMs (Fig. 1C). Intriguingly, the effect of RA inhibition is similar between WT and isolated hearts, suggesting a synergic role of Wnt and RA pathways in the regulation of pgam2 during zebrafish development. Here, we report the first study illustrating the relationship between the Wnt pathway and Pgam2 in zebrafish hearts (Fig. 1F). While the role of Wnt in the metabolic reprogramming in tumors has been already indicated (Koushyar et al. 2022; Tümen et al. 2024), the relationship between Wnt and basic metabolism in zebrafish heart and cardiovascular pathologies has not been clarified. For its well-known versatility as a model system in development and disease (Westerfield 2007) and the recent gain of significance in metabolic studies (Benchoula et al. 2019; Abou Azar and Lim 2021), zebrafish represent a valid target to study metabolic physiological interactions. Through well-established pharmacological manipulations (Coppola et al. 2024; DeWildt et al. 2026), we highlighted a clear control exerted by Wnt on pgam2 during zebrafish early development. Specifically, we registered higher pgam2 expression in CMs and higher effect of Wnt on gene expression in isolated hearts, suggesting a more relevant effect/control in cardiovascular development. Intriguingly, our epistatic approaches unveiled a contribution of the RA pathway in the relationship existing between Wnt and pgam2 in zebrafish CMs, suggesting a potential RA-Wnt interaction in the control of pgam2 expression in the heart, with Wnt playing a major role in this context (Fig. 1F). Additionally, since Pgam2 has a significant role in the control of the balance between glycolytic pathway and cholesterol metabolism (Guo et al. 2024), our findings pave the way to further experiments towards the understanding of Wnt impact of general metabolism in the heart. Furthermore, both the incidence of Wnt defects on mammalian metabolic homeostasis (Abou Azar and Lim 2021) and the implication of TCF7L2 mutations in murine overt metabolic phenotypes (Nguyen-Tu et al. 2021) align with our pharmacological approach. Hence, our zebrafish data speak in favor of a conserved Wnt involvement in the regulation of a key metabolic gene, Pgam2, in the context of heart development. Intriguingly, human PGAM2 gene has been associated with Glycogen Storage Disease Type X (GSD X) (Tsujino et al. 1993; Hadjigeorgiou et al. 1999; Nayab et al. 2021), which severely affects muscle basic functionalities. Furthermore, BIO activates Wnt signaling through the inhibition of the Glycogen synthase kinase 3 (Gsk3) (Law and Zheng 2022), which is a pivotal element of balance in the cellular metabolism (Wang et al. 2022). On the other hand, XAV939 effectively blocks Wnt signaling interacting with Tankyrases (Wu et al. 2016), which in cancer cells promote aerobic glycolysis (Yang et al. 2019). Thus, it is tempting to speculate a control exerted by Wnt signaling on the basal metabolism in the heart through Pgam2. In cancer cells, both Wnt signaling (Flores-Hernández et al. 2025) and PGAM2 (Gizak et al. 2015; Wang et al. 2025) impact basal metabolism, highlighting a molecular and functional relationship existing in multiple tissues. Furthermore, the Pgam2 overexpression causes cardiac weakness in mice (Okuda et al. 2013) and PGAM2 resulted in overexpression in patients affected by heart failure (Li et al. 2021), both supporting its involvement in the regulation of basic cardiac development. With respect to PGAM2 implication in cardiac defects, it has been identified as a marker for cardiac ischemia (Li et al. 2012) and associated with cardiac hypertrophy (Li et al. 2025). Additionally, N6-methyladenosine (m6A) post-transcriptional modifications cause glycolytic impairments in the heart of murine obesity models (Zhang et al. 2021). Henceforth, in light of the significance of Pgam2 orthologs in cardiac development and disease and for its strategic position among distinct metabolic pathways (Guo et al. 2024), future studies will aim to completely decipher the role of Wnt in regulating pgam2 and other genes within specific metabolic pathways (glycolysis, cholesterol, TCA), shedding light on novel Wnt-dependent gene regulatory networks (GRNs) in zebrafish (and vertebrate) hearts.
","references":[{"reference":"Abou Azar F, Lim GE. 2021. Metabolic contributions of Wnt signaling: More than controlling flight. Front. Cell Dev. Biol. 9: 709823.","pubmedId":"","doi":"10.3389/fcell.2021.709823"},{"reference":"Angom RS, Nakka NMR. 2024. Zebrafish as a model for cardiovascular and metabolic disease: The future. Biomedicines. 12: 693.","pubmedId":"","doi":"10.3390/biomedicines12030693"},{"reference":"Benchoula K, Khatib A, Jaffar A, Ahmed QU, Sulaiman WMAW, Wahab RA, El Seedi HR. 2019. The promise of zebrafish as a model of metabolic syndrome. Exp. Anim. 68: 407-416.","pubmedId":"","doi":"10.1538/expanim.18-0168"},{"reference":"Burns CG, Mac Rae CA. 2006. Purification of hearts from zebrafish embryos. Biotechniques. 40: 274, 276, 278 passim.","pubmedId":"","doi":"10.2144/000112135"},{"reference":"Coppola U, Saha B, Kenney J, Waxman JS. 2024. A Foxf1-Wnt-Nr2f1 cascade promotes atrial cardiomyocyte differentiation in. PLoS Genet. 20: e1011222.","pubmedId":"","doi":"10.1371/journal.pgen.1011222"},{"reference":"D Aniello E, Rydeen AB, Anderson JL, Mandal A, Waxman JS. 2013. Depletion of retinoic acid receptors initiates a novel positive feedback. PLoS Genet. 9: e1003689.","pubmedId":"","doi":"10.1371/journal.pgen.1003689"},{"reference":"De Wildt LV, Hildenbrand MA, Manchester CD, Prawiradilaga SI, Ristoratore F, Coppola U. 2026. The unexplored evolutionary history of Nedd genes in metazoans. Front. Ecol. Evol. 14: 1851122.","pubmedId":"","doi":"10.3389/fevo.2026.1851122"},{"reference":"El Haddad M, Notarnicola C, Evano B, El Khatib N, Blaquiere M, Bonnieu A, et al., Carnac G. 2017. Retinoic acid maintains human skeletal muscle progenitor cells in an. Cell. Mol. Life Sci. 74: 1923-1936.","pubmedId":"","doi":"10.1007/s00018-016-2445-1"},{"reference":"Flores Hernandez E, Binder G, Mei KC, Tejeda Munoz N. 2025. Targeting Wnt-driven metabolic adaptations in cancer: integrating. Front. Cell Dev. Biol. 13: 1622218.","pubmedId":"","doi":"10.3389/fcell.2025.1622218"},{"reference":"Gizak A, Grenda M, Mamczur P, Wisniewski J, Sucharski F, Silberring J, et al., Rakus D. 2015. Insulin/IGF1-PI3K-dependent nucleolar localization of a glycolytic enzyme. Oncotarget. 6: 17237-17250.","pubmedId":"","doi":"10.18632/oncotarget.4044"},{"reference":"Guo J, Chen S, Zhang Y, Liu J, Jiang L, Hu L, et al., Chen X. 2024. Cholesterol metabolism: physiological regulation and diseases. MedComm. 5: e476.","pubmedId":"","doi":"10.1002/mco2.476"},{"reference":"Hadjigeorgiou GM, Kawashima N, Bruno C, Andreu AL, Sue CM, Rigden DJ, et al., Di Mauro S. 1999. Manifesting heterozygotes in a Japanese family with a novel mutation in. Neuromuscul. Disord. 9: 399-402.","pubmedId":"","doi":"10.1016/s0960-8966(99)00039-5"},{"reference":"Huang CJ, Tu CT, Hsiao CD, Hsieh FJ, Tsai HJ. 2003. Germ-line transmission of a myocardium-specific GFP transgene reveals. Dev. Dyn. 228: 30-40.","pubmedId":"","doi":"10.1002/dvdy.10356"},{"reference":"Iwata R, Vanderhaeghen P. 2024. Metabolic mechanisms of species-specific developmental tempo. Dev. Cell. 59: 1628-1639.","pubmedId":"","doi":"10.1016/j.devcel.2024.05.027"},{"reference":"Koushyar S, Meniel VS, Phesse TJ, Pearson HB. 2022. Exploring the Wnt pathway as a therapeutic target for prostate cancer. Biomolecules. 12: 309.","pubmedId":"","doi":"10.3390/biom12020309"},{"reference":"Law SM, Zheng JJ. 2022. Premise and peril of Wnt signaling activation through GSK-3β inhibition. iScience. 25: 104159.","pubmedId":"","doi":"10.1016/j.isci.2022.104159"},{"reference":"Li H, Li J, Wang Y, Yang T. 2012. Proteomic analysis of effluents from perfused human heart for. Proteome Sci. 10: 21.","pubmedId":"","doi":"10.1186/1477-5956-10-21"},{"reference":"Li M, Gao X, Wang H, Zhang M, Li X, Wang S, et al., Su G. 2021. Phosphoglycerate mutase 2 is elevated in serum of patients with heart. Open Med. (Warsz.). 16: 1134-1142.","pubmedId":"","doi":"10.1515/med-2021-0324"},{"reference":"Li Y, Li WJ, Du JM, Wu HH, Zhou SY, Li M, et al., Su GH. 2025. Downregulation of PGAM2 alleviates angiotensin II-induced cardiac. Int. J. Biol. Sci. 21: 1308-1321.","pubmedId":"","doi":"10.7150/ijbs.102251"},{"reference":"Liang W, Han P, Kim EH, Mak J, Zhang R, Torrente AG, et al., Cho HC. 2020. Canonical Wnt signaling promotes pacemaker cell specification of cardiac. Stem Cells. 38: 352-368.","pubmedId":"","doi":"10.1002/stem.3106"},{"reference":"Nayab A, Alam Q, Alzahrani OR, Khan R, Sarfaraz S, Albaz AA, et al., Umair M. 2021. Targeted exome sequencing identified a novel frameshift variant in the. Eur. J. Med. Genet. 64: 104283.","pubmedId":"","doi":"10.1016/j.ejmg.2021.104283"},{"reference":"Nguyen Tu MS, Martinez Sanchez A, Leclerc I, Rutter GA, Da Silva Xavier G. 2021. Adipocyte-specific deletion of Tcf7l2 induces dysregulated lipid. Diabetologia. 64: 129-141.","pubmedId":"","doi":"10.1007/s00125-020-05292-4"},{"reference":"Okuda J, Niizuma S, Shioi T, Kato T, Inuzuka Y, Kawashima T, et al., Kimura T. 2013. Persistent overexpression of phosphoglycerate mutase, a glycolytic enzyme,. PLoS One. 8: e72173.","pubmedId":"","doi":"10.1371/journal.pone.0072173"},{"reference":"Singh MK, Yadav R, Bhaskar AK, Sengupta S, Sachidanandan C. 2023. A diet-independent zebrafish model for NAFLD recapitulates patient lipid. Biochim. Biophys. Acta Mol. Cell Biol. Lipids. 1868: 159246.","pubmedId":"","doi":"10.1016/j.bbalip.2022.159246"},{"reference":"Tsujino S, Shanske S, Sakoda S, Fenichel G, Di Mauro S. 1993. The molecular genetic basis of muscle phosphoglycerate mutase (PGAM). Am. J. Hum. Genet. 52: 472-477.","pubmedId":"","doi":""},{"reference":"Tumen D, Heumann P, Huber J, Hahn N, Macek C, Ernst M, et al., Gulow K. 2024. Unraveling cancer’s Wnt signaling: Dynamic control through protein kinase. Cancers (Basel). 16: 2686.","pubmedId":"","doi":"10.3390/cancers16152686"},{"reference":"Ueno S, Weidinger G, Osugi T, Kohn AD, Golob JL, Pabon L, et al., Murry CE. 2007. Biphasic role for Wnt/β-catenin signaling in cardiac specification in. Proceedings of the National Academy of Sciences. 104: 9685-9690.","pubmedId":"","doi":"10.1073/pnas.0702859104"},{"reference":"Wang L, Li J, Di LJ. 2022. Glycogen synthesis and beyond, a comprehensive review of GSK3 as a key. Med. Res. Rev. 42: 946-982.","pubmedId":"","doi":"10.1002/med.21867"},{"reference":"Wang Z, Guo Y, Hu K, He T, Qin T, Zhang L, et al., Zhao Q. 2025. Hepatocellular carcinoma cells downregulate PGAM2 via SIRT2-mediated. NPJ Precis. Oncol. 9","pubmedId":"","doi":"10.1038/s41698-025-00930-9"},{"reference":"Westerfield M. 2007. The Zebrafish Book; A guide for the laboratory use of zebrafish (Danio. (No Title)","pubmedId":"","doi":""},{"reference":"Wu X, Luo F, Li J, Zhong X, Liu K. 2016. Tankyrase 1 inhibitior XAV939 increases chemosensitivity in colon cancer. Int. J. Oncol. 48: 1333-1340.","pubmedId":"","doi":"10.3892/ijo.2016.3360"},{"reference":"Yang HY, Shen JX, Wang Y, Liu Y, Shen DY, Quan S. 2019. Tankyrase promotes aerobic glycolysis and proliferation of ovarian cancer. Biomed Res. Int. 2019: 1-14.","pubmedId":"","doi":"10.1155/2019/2686340"},{"reference":"Zhang B, Jiang H, Wu J, Cai Y, Dong Z, Zhao Y, et al., Ge J. 2021. m6A demethylase FTO attenuates cardiac dysfunction by regulating glucose. Signal Transduct. Target. Ther. 6: 377.","pubmedId":"","doi":"10.1038/s41392-021-00699-w"}],"title":"Pilot: Wnt signaling controls pgam2 expression in zebrafish cardiomyocytes
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Holly Paddock"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"70cd1fd4-c792-4991-bb03-67459b978aac","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}