The hypoxia-inducible factor 1 (HIF-1)-mediated hypoxia response is an evolutionarily conserved stress response that enables adaptation to conditions of low oxygen and mitochondrial dysfunction. This pathway has been shown to affect both stress resistance and longevity. HIF-1 activity is regulated by EGL-9, VHL-1, and RHY-1 and induces the expression of genes involved in metabolism and cellular resilience. To find reproducible HIF-1 target genes, we compared HIF-1 targets identified by multiple RNA-seq and ChIP-seq experiments, including our own data. From this analysis, we identified high-confidence HIF-1 target genes that provide robust markers of pathway activation.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"camille.desnos@mail.mcgill.ca","firstName":"Camille AH","lastName":"Desnos","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"aura.tamezgonzalez@mail.mcgill.ca","firstName":"Aura A","lastName":"Tamez Gonzalez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, Quebec, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["conceptualization","formalAnalysis","investigation","methodology","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"jeremy.vanraamsdonk@mcgill.ca","firstName":"Jeremy M","lastName":"Van Raamsdonk","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0001-8376-9605"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table S1
","doi":null,"resourceType":"Dataset","name":"Table S1 HIF-1.xlsx","url":"https://portal.micropublication.org/uploads/40af01cad2b86117b492df19744fab6a.xlsx"}],"funding":"This work was supported by the Canadian Institutes of Health Research (CIHR; http://www.cihr-irsc.gc.ca/; JVR) and the Natural Sciences and Engineering Research Council of Canada (NSERC; https://www.nserc-crsng.gc.ca/index_eng.asp; JVR). JVR received a Senior Research Scholar career award from the Fonds de Recherche du Quebec Santé (FRQS) and Parkinson Quebec. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
","image":{"url":"https://portal.micropublication.org/uploads/2c0b823d7a5e7611a52f6e73ab98fec0.jpg"},"imageCaption":"(A) Overview of HIF-1 mediated hypoxia pathway. Under normal oxygen condition (normoxia) HIF-1 is hydroxylated by EGL-1. Hydroxylated HIF-1 is recognized and ubiquitinated by VHL-1 (Ub = ubiquitin groups). Ubiquitinated HIF-1 is degraded by the proteasome. Under hypoxic conditions, EGL-9 cannot hydroxylate HIF-1. As a result, HIF-1 travels to the nucleus to change gene expression with AHA-1. (B) Weighted Venn diagram showing overlap of HIF-1 target genes identified by Shen et al., Feng et al. and Vora et al. using RNA-seq. (C) Expression of HIF-1 target genes in nuo-6 and nuo-6;hif-1 mutants from RNA-seq data. (D) Heat map showing expression of top HIF-1 target genes in a panel of nine long-lived mutants. The greatest number of HIF-1 target genes are activated in nuo-6 and isp-1 mitochondrial mutants, while the fewest are activated in osm-5 and eat-2 mutants. (E) The expression levels of high confidence HIF-1 target genes in isp-1 and isp-1;hif-1 mutants using qPCR. Statistical significance was determined using a two-way ANOVA with Šidák’s multiple comparisons test in panel C and a one-way ANOVA with Dunnett’s multiple comparisons test in panel E. ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
","imageTitle":"
Identification of high confidence HIF-1 target genes
","methods":"Strains
The following strains were used: N2 (wild-type), isp-1(qm150), isp-1(qm150);hif-1(ia4). Strains were maintained at 20°C on NGM plates seeded with OP50 E. coli bacteria.
RNA Isolation
Worms were synchronized by a 4-hour limited time egg laying, collected at the pre-fertile young adult stage, and washed 3 times with M9. Trizol was then added and the samples were frozen in liquid nitrogen and kept at –80°C until RNA isolation. To extract the RNA, the pellet was thawed and re-frozen in liquid nitrogen 3 times, after which more Trizol was added to a total volume of 250 µl. This was followed by 3 vortex cycles consisting of 30s vortexing and 30s at room temperature. Samples were then left to sit at room temperature for 15 minutes and chloroform was added at 1:5 volume of Trizol. After shaking for 15 seconds, samples were left to sit at room temperature for 3 minutes. Then, samples were centrifuged at 12,000 x g for 15 minutes at 4°C, and the upper aqueous phase was transferred to a new tube. An equal volume of isopropanol was added, and it was left sitting on ice for 1 hour. After, samples were centrifuged at 12,000 x g for 20 minutes at 4°C, the supernatant was removed, and the pellet was washed with 75% ethanol. Then, samples were centrifuged at 12,000 x g for 10 minutes at 4°C, the ethanol was removed, and 100% ethanol was added before centrifuging at 12,000 x g for 3 minutes. The ethanol was removed and the pellet was air dried for 5 minutes until no traces of ethanol were found. The pellet was then dissolved in RNAse free double distilled water. RNA was isolated from 3 biological replicates.
Quantitative PCR
The samples underwent DNase I treatment to remove genomic DNA, using a DNase I, RNase-free kit (Thermo Scientific) following the manufacturer's instructions. Then, cDNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems), according to the manufacturer's protocol. qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a Viia7 Real Time PCR System (Applied Biosystems). RNA levels were normalized using actin.
Primers
The sequences for the primers used for qPCR are below:
egl-9 L TCGACAACCCTCCAAGAACA
egl-9 R GGCTTCTGATCACATGCTCG
F22B5.4 L ATGTTCCATCGCCAGCAAGA
F22B5.4 R ACGGCGGACAAGGAATTGATA
sqrd-1 L TGGTGGGTCATTACAGTCCAAA
sqrd-1 R TACATGGCCGATTACCCTGC
cysl-2 L TGGGTGGAATCTCGTCTGGA
cysl-2 R CGTAGAGGGCGGTTGAAAGAT
mce-1 L TTCGCTGTCCACAAGAACCAT
mce-1 R TAACTTTTGCTCCGAGGCCC
pck-1 L CCACGTCCAGTTAAGCAAAAGG
pck-1 R AGCGAAGCACTTCTTTCCGA
Strains utilized:
Strain Name | Genotype | Source |
N2 | wild-type | CGC |
MQ887 | isp-1(qm150) | Hekimi lab |
JVR023 | isp-1(qm150);hif-1(ia4) | Genetic cross |
The HIF-1-mediated hypoxia pathway is a pathway of cellular resilience that is activated under conditions of low oxygen (hypoxia). The transcriptional changes for this pathway are mediated by the HIF-1 transcription factor, which acts in a heterodimer with AHA-1. hif-1 encodes the HIF-1α subunit, which is sensitive to oxygen levels, while aha-1 encodes the constitutively expressed HIF-1β subunit. Under normoxic conditions, HIF-1 is hydroxylated by the prolyl hydroxylase EGL-9 (Epstein et al., 2001). Hydroxylated HIF-1 can then be recognized by the von Hippel-Lindau E3 ubiquitin ligase VHL-1, resulting in ubiquitination and proteasomal degradation of HIF-1 (Bishop et al., 2004). Under hypoxic conditions (0.1% - 1% oxygen), there are insufficient levels of oxygen for EGL-9 to hydroxylate HIF-1. As a result, HIF-1 is not hydroxylated and not marked for degradation by VHL-1. Instead, HIF-1 is able to accumulate in the nucleus and induce changes in gene expression. HIF-1 can also escape degradation when either EGL-9 or VHL-1 are disrupted. In addition, HIF-1 degradation can be prevented by disrupting the RHY-1 (Regular of hypoxia-inducible factor-1) transmembrane protein, which normally acts to reduce CYSL-1 levels and prevent CYSL-1 from binding to and inhibiting EGL-9 (Kruempel et al., 2020; Shen et al., 2006).
A number of previous studies have demonstrated a role for the HIF-1-mediated hypoxia response in lifespan determination. Increasing the levels or activation of HIF-1 either directly or through disruption of its negative regulators vhl-1, egl-9, or rhy-1, extends lifespan, indicating that activation of the hypoxia pathway can promote longevity (Kruempel et al., 2020; Leiser et al., 2015; Mehta et al., 2009; Zhang et al., 2009). In contrast, the results of studies examining the effects of hif-1 disruption on lifespan have been more varied with some experiments showing increased, decreased, or unchanged lifespan depending on the exact conditions utilized (Leiser and Kaeberlein, 2010). HIF-1 has also been shown to contribute to the longevity of multiple long-lived mutants. HIF-1 is required for lifespan extension in the long-lived mitochondrial mutants clk-1, isp-1 and nuo-6 (Lee et al., 2010; Wu et al., 2018), but dispensable for the enhanced longevity of daf-2, eat-2, glp-1 and osm-5 mutants (Lee et al., 2010; Soo et al., 2023). The HIF-1 target gene fmo-2 is required for the lifespan extension induced by dietary restriction and by mild mitochondrial dysfunction (Leiser et al., 2015; Van Raamsdonk, 2026).
Multiple previous studies have identified transcriptional targets of HIF-1 using RNA sequencing (RNA-seq) to find which genes are differentially expressed following HIF-1 activation. Shen et al. identified genes that are upregulated during hypoxia with p<0.05 and fold change greater than or equal to 2 and not upregulated by hypoxia in hif-1(ia4) mutants (Shen et al., 2005). Vora et al. identified genes that are upregulated in egl-9(sa307) and egl-9(sa307);hif-1(ia4):odIs131[hif-1::gfp] mutants compared to wild-type and egl-9;hif-1(ia4) worms (Vora et al., 2022). Feng et al. identified genes that are induced by 1.6 fold more in wild-type worms compared to hif-1(ia4) worms after a 2 hour exposure to hypoxia (Feng et al., 2024b). In a separate paper, Feng et al. identified genes upregulated in vhl-1(ok161), rhy-1(ok1402), egl-9(sa307) and swan-1(ok267);vhl-1(ok161) worms and made a list of genes commonly upregulated amongst all four strains (Feng et al., 2024a). Doering et al. identified genes upregulated by hypoxia in wild-type worms and nhr-49 mutants but not in hif-1 mutants (Doering et al., 2022). We previously compared gene expression between isp-1 and isp-1;hif-1 mutants, as the HIF-1-mediated hypoxia pathway has been found to be activated in isp-1 mutants (Lee et al., 2010). HIF-1 targets were selected as genes that are upregulated by at least 30% in isp-1 worms compared to wild-type worms and decreased by at least 30% in isp-1;hif-1 worms compared to isp-1 worms.
In addition to these RNA-seq experiments, two studies have used Chromatin Immunoprecipitation sequencing (ChIP-seq) to find which gene promoters are bound by HIF-1 following activation. Feng et al. performed a ChIP-Seq experiment in which the hif-1a isoform was labelled with a HA tag in the egl-9(sa307) background and an anti-HA antibody was used for ChIP (Feng et al., 2024b). Vora et al. performed a ChIP-Seq experiment in which egl-9(sa307);hif-1(ia4);odIs131[hif-1::gfp] worms were compared to hif-1(ia4);odIs131[hif-1::gfp] worms (Vora et al., 2022).
To identify high confidence HIF-1 target genes, we initially compared the gene sets identified by Shen et al. (genes upregulated during hypoxia in a hif-1-dependent manner), Vora et al. (genes upregulated by egl-9 mutation in a hif-1-dependent manner) and Feng et al. (genes induced 1.6 fold more in wild-type worms than hif-1 worms after hypoxia) (Figure 1B). We found that there were 41 genes in at least two of these gene sets with just 8 genes found in all three. We then examined whether these 41 genes were identified in the other RNA-seq experiments and the published ChIP-Seq experiments. We found that three genes were identified in seven of the eight studies (Extended Data Table S1) (The ChIP-seq experiment by Feng et al. only identified one of the 41 genes). This included egl-9, F22B5.4 and sqrd-1. There were 8 more genes that were identified in six of the eight studies: efk-1, phy-2, cysl-2, gbh-2, ethe-1, mce-1, ZK550.6, and pck-1.
As we have previously used RNA sequencing to examine gene expression in nuo-6 and nuo-6;hif-1 worms, as well as wild-type and hif-1 worms (Wu et al., 2018), we next examined the expression of a selection of these genes using this RNA-seq data. We found that disruption of hif-1 significantly decreased the expression of F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1, thereby providing additional support for these genes as targets of HIF-1 (Figure 1C).
We recently examined gene expression in a panel of nine long-lived mutants representing multiple different pathways of lifespan extension (Rudich et al., 2025). To determine the extent to which the HIF-1-hypoxia pathway is activated in each of these strains, we examined the expression of HIF-1 target genes that were identified by at least four of the eight studies we examined. We found that nuo-6 and isp-1 showed the greatest activation of HIF-1 target genes, while osm-5 and eat-2 worms showed the least activation (Figure 1D). This is consistent with our observation that nuo-6 and isp-1 belong to a different longevity group than osm-5 and eat-2 worms, based on gene expression (Rudich et al., 2025).
In order to facilitate other researchers quantifying the expression of HIF-1 target genes to measure activation of the HIF-1-hypoxia response, we designed primers to measure six of the high confidence HIF-1 target genes using quantitative RT-PCR. These genes included egl-9, F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1. To test the function of these primers, we isolated RNA from isp-1 and isp-1;hif-1 worms with wild-type worms as control. As anticipated, we found that the expression of all six selected HIF-1 target genes is upregulated in isp-1 mutants and the upregulation of these genes in isp-1 worms is completely prevented by the disruption of hif-1 (Figure 1E). This confirms that these genes are target genes of HIF-1 and that the primers we designed can be used to effectively measure the expression levels of these HIF-1 target genes.
Overall, this work combined multiple previous RNA-seq and ChIP-seq studies to identify high confidence HIF-1 target genes that can be used to monitor the activation of the HIF-1-mediated hypoxia response. We also designed and validated qPCR primers to quantify these genes using quantitative RT-PCR.
Bishop T, Lau KW, Epstein ACR, Kim SK, Jiang M, O'Rourke D, et al., Ratcliffe. 2004. Genetic Analysis of Pathways Regulated by the von Hippel-Lindau Tumor Suppressor in Caenorhabditis elegans. PLoS Biology 2: e289.
","pubmedId":"","doi":"10.1371/journal.pbio.0020289"},{"reference":"Doering KR, Cheng X, Milburn L, Ratnappan R, Ghazi A, Miller DL, Taubert S. 2022. Nuclear hormone receptor NHR-49 acts in parallel with HIF-1 to promote hypoxia adaptation in Caenorhabditis elegans. eLife 11: 10.7554/elife.67911.
","pubmedId":"","doi":"10.7554/eLife.67911"},{"reference":"Epstein ACR, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR, et al., Ratcliffe. 2001. C. elegans EGL-9 and Mammalian Homologs Define a Family of Dioxygenases that Regulate HIF by Prolyl Hydroxylation. Cell 107: 43-54.
","pubmedId":"","doi":"10.1016/s0092-8674(01)00507-4"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Whole genome profiling of short-term hypoxia induced genes and identification of HIF-1 binding sites provide insights into HIF-1 function in Caenorhabditis elegans. PLOS ONE 19: e0295094.
","pubmedId":"","doi":"10.1371/journal.pone.0295094"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Transcriptome analyses describe the consequences of persistent HIF-1 over-activation in Caenorhabditis elegans. PLOS ONE 19: e0295093.
","pubmedId":"","doi":"10.1371/journal.pone.0295093"},{"reference":"Kruempel JCP, Miller HA, Schaller ML, Fretz A, Howington M, Sarker M, Huang S, Leiser SF. 2020. Hypoxic response regulators RHY-1 and EGL-9/PHD promote longevity through a VHL-1-independent transcriptional response. GeroScience 42: 1621-1633.
","pubmedId":"","doi":"10.1007/s11357-020-00194-0"},{"reference":"Lee SJ, Hwang AB, Kenyon C. 2010. Inhibition of Respiration Extends C. elegans Life Span via Reactive Oxygen Species that Increase HIF-1 Activity. Current Biology 20: 2131-2136.
","pubmedId":"","doi":"10.1016/j.cub.2010.10.057"},{"reference":"Leiser SF, Kaeberlein M. 2010. The hypoxia-inducible factor HIF-1 functions as both a positive and negative modulator of aging. Biological Chemistry 391: 10.1515/bc.2010.123.
","pubmedId":"","doi":"10.1515/BC.2010.123"},{"reference":"Leiser SF, Miller H, Rossner R, Fletcher M, Leonard A, Primitivo M, et al., Kaeberlein. 2015. Cell nonautonomous activation of flavin-containing monooxygenase promotes longevity and health span. Science 350: 1375-1378.
","pubmedId":"","doi":"10.1126/science.aac9257"},{"reference":"Mehta R, Steinkraus KA, Sutphin GL, Ramos FJ, Shamieh LS, Huh A, et al., Kaeberlein. 2009. Proteasomal Regulation of the Hypoxic Response Modulates Aging in\n C. elegans. Science 324: 1196-1198.
","pubmedId":"","doi":"10.1126/science.1173507"},{"reference":"Rudich ZD, Guan J, Tamez Gonzalez AA, Booth GF, Soo SK, Anglas U, et al., Van Raamsdonk. 2025. Multiple Molecular Pathways to Longevity: Opposing Gene Expression Programs Define Distinct Aging Strategies. : 10.64898/2025.12.29.696944.
","pubmedId":"","doi":"10.64898/2025.12.29.696944"},{"reference":"Shen C, Nettleton D, Jiang M, Kim SK, Powell-Coffman JA. 2005. Roles of the HIF-1 Hypoxia-inducible Factor during Hypoxia Response in Caenorhabditis elegans. Journal of Biological Chemistry 280: 20580-20588.
","pubmedId":"","doi":"10.1074/jbc.M501894200"},{"reference":"Shen C, Shao Z, Powell-Coffman JA. 2006. The Caenorhabditis elegans rhy-1 Gene Inhibits HIF-1 Hypoxia-Inducible Factor Activity in a Negative Feedback Loop That Does Not Include vhl-1. Genetics 174: 1205-1214.
","pubmedId":"","doi":"10.1534/genetics.106.063594"},{"reference":"Soo SK, Rudich ZD, Ko B, Moldakozhayev A, AlOkda A, Van Raamsdonk JM. 2023. Biological resilience and aging: Activation of stress response pathways contributes to lifespan extension. Ageing Research Reviews 88: 101941.
","pubmedId":"","doi":"10.1016/j.arr.2023.101941"},{"reference":"Van Raamsdonk JM. 2026. Mild mitochondrial impairment activates overlapping longevity pathways converging on the flavin-containing monooxygenase FMO-2. Frontiers in Aging 7: 10.3389/fragi.2026.1808540.
","pubmedId":"","doi":"10.3389/fragi.2026.1808540"},{"reference":"Vora M, Pyonteck SM, Popovitchenko T, Matlack TL, Prashar A, Kane NS, et al., Rongo. 2022. The hypoxia response pathway promotes PEP carboxykinase and gluconeogenesis in C. elegans. Nature Communications 13: 10.1038/s41467-022-33849-x.
","pubmedId":"","doi":"10.1038/s41467-022-33849-x"},{"reference":"Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, et al., Van Raamsdonk. 2018. Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways. BMC Biology 16: 10.1186/s12915-018-0615-3.
","pubmedId":"","doi":"10.1186/s12915-018-0615-3"},{"reference":"Zhang Y, Shao Z, Zhai Z, Shen C, Powell-Coffman JA. 2009. The HIF-1 Hypoxia-Inducible Factor Modulates Lifespan in C. elegans. PLoS ONE 4: e6348.
","pubmedId":"","doi":"10.1371/journal.pone.0006348"}],"title":"High confidence HIF-1 target genes for quantifying the activation of the HIF-1-mediated hypoxia response
","reviews":[{"reviewer":{"displayName":"Scott Leiser"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"1725b022-df11-4728-807a-d78df702ecd5","decision":"accept","abstract":"The hypoxia-inducible factor 1 (HIF-1)-mediated hypoxia response is an evolutionarily conserved stress response that enables adaptation to conditions of low oxygen and mitochondrial dysfunction. This pathway has been shown to affect both stress resistance and longevity. HIF-1 activity is regulated by EGL-9, VHL-1, and RHY-1 and induces the expression of genes involved in metabolism and cellular resilience. To find genes that can be used to monitor HIF-1 activation, we compared HIF-1 modulated genes identified by multiple RNA-seq experiments and HIF-1 target genes identified by ChIP-seq experiments. We identified high-confidence HIF-1 target genes that provide robust markers of pathway activation.
","acknowledgements":"
Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"camille.desnos@mail.mcgill.ca","firstName":"Camille AH","lastName":"Desnos","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"aura.tamezgonzalez@mail.mcgill.ca","firstName":"Aura A","lastName":"Tamez Gonzalez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, Quebec, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["conceptualization","formalAnalysis","investigation","methodology","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"jeremy.vanraamsdonk@mcgill.ca","firstName":"Jeremy M","lastName":"Van Raamsdonk","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0001-8376-9605"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table S1
","doi":null,"resourceType":"Dataset","name":"Table S1 HIF-1.xlsx","url":"https://portal.micropublication.org/uploads/40af01cad2b86117b492df19744fab6a.xlsx"},{"description":"Extended Data File 1. Binding location and amplicon sizes of qPCR primers.
","doi":null,"resourceType":"Text","name":"qPCR Primers.docx","url":"https://portal.micropublication.org/uploads/8214477323886a4c58615ef9baa7d287.docx"}],"funding":"This work was supported by the Canadian Institutes of Health Research (CIHR; http://www.cihr-irsc.gc.ca/; JVR) and the Natural Sciences and Engineering Research Council of Canada (NSERC; https://www.nserc-crsng.gc.ca/index_eng.asp; JVR). JVR received a Senior Research Scholar career award from the Fonds de Recherche du Quebec Santé (FRQS) and Parkinson Quebec. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
","image":{"url":"https://portal.micropublication.org/uploads/2c0b823d7a5e7611a52f6e73ab98fec0.jpg"},"imageCaption":"(A) Overview of HIF-1 mediated hypoxia pathway. Under normal oxygen condition (normoxia) HIF-1 is hydroxylated by EGL-9. Hydroxylated HIF-1 is recognized and ubiquitinated by VHL-1 (Ub = ubiquitin groups). Ubiquitinated HIF-1 is degraded by the proteasome. Under hypoxic conditions, EGL-9 cannot hydroxylate HIF-1. As a result, HIF-1 travels to the nucleus to change gene expression with AHA-1. (B) Weighted Venn diagram showing overlap of HIF-1 modulated genes identified by Shen et al., Feng et al. and Vora et al. using RNA-seq. (C) Expression of HIF-1 target genes in nuo-6 and nuo-6;hif-1 mutants from RNA-seq data. (D) Heat map showing expression of top HIF-1 modulated genes in a panel of nine long-lived mutants. Expression is indicated as a percentage of wild-type expression. The heatmap was generated using Morpheus: https://software.broadinstitute.org/morpheus/ The greatest number of HIF-1 modulated genes are activated in nuo-6 and isp-1 mitochondrial mutants, while the fewest are activated in osm-5 and eat-2 mutants. RNA-seq data for the heat map is from Rudich et al. 2026, eLife. The RNA-seq data is available at NCBI GEO: GSE179825, GSE93724, GSE110984. (E) The expression levels of high confidence HIF-1 target genes in isp-1 and isp-1;hif-1 mutants using qPCR. Expression levels were normalized to act-3 and then expressed as a percentage of wild-type expression. Statistical significance was determined using a two-way ANOVA with Šidák's multiple comparisons test in panel C and a one-way ANOVA with Dunnett's multiple comparisons test in panel E. ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
","imageTitle":"
Identification of high confidence HIF-1 target genes
","methods":"Strains
The following strains were used: N2 (wild-type), isp-1(qm150), isp-1(qm150);hif-1(ia4). Strains were maintained at 20°C on NGM plates seeded with OP50 E. coli bacteria.
RNA Isolation
Worms were synchronized by a 4-hour limited time egg laying, collected at the pre-fertile young adult stage, and washed 3 times with M9. Trizol was then added and the samples were frozen in liquid nitrogen and kept at –80°C until RNA isolation. To extract the RNA, the pellet was thawed and re-frozen in liquid nitrogen 3 times, after which more Trizol was added to a total volume of 250 µl. This was followed by 3 vortex cycles consisting of 30s vortexing and 30s at room temperature. Samples were then left to sit at room temperature for 15 minutes and chloroform was added at 1:5 volume of Trizol. After shaking for 15 seconds, samples were left to sit at room temperature for 3 minutes. Then, samples were centrifuged at 12,000 x g for 15 minutes at 4°C, and the upper aqueous phase was transferred to a new tube. An equal volume of isopropanol was added, and it was left sitting on ice for 1 hour. After, samples were centrifuged at 12,000 x g for 20 minutes at 4°C, the supernatant was removed, and the pellet was washed with 75% ethanol. Then, samples were centrifuged at 12,000 x g for 10 minutes at 4°C, the ethanol was removed, and 100% ethanol was added before centrifuging at 12,000 x g for 3 minutes. The ethanol was removed and the pellet was air dried for 5 minutes until no traces of ethanol were found. The pellet was then dissolved in RNAse free double distilled water. RNA was isolated from 3 biological replicates.
Quantitative PCR
The samples underwent DNase I treatment to remove genomic DNA, using a DNase I, RNase-free kit (Thermo Scientific) following the manufacturer's instructions. Then, cDNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems), according to the manufacturer's protocol. qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a Viia7 Real Time PCR System (Applied Biosystems). RNA levels were normalized to the expression of the act-3 gene. After running the RT-PCR, expression levels were calculated as 2-CT (CT is the cycle threshold, which is the number of cycles at which time the fluorescence crosses a specified threshold). The expression levels for each individual gene was then divided by the expression level of the control gene act-3. Finally, the copies/copy act-3 was divided by the average copies/copy act-3 of the wild-type samples. Three biological replicates were performed.
Primers
The sequences for the primers used for qPCR are below:
Gene | Primer 1 | Primer 2 | Amplicon Size |
TCGACAACCCTCCAAGAACA | GGCTTCTGATCACATGCTCG | 115 bp | |
ATGTTCCATCGCCAGCAAGA | ACGGCGGACAAGGAATTGATA | 146 bp | |
TGGTGGGTCATTACAGTCCAAA | TACATGGCCGATTACCCTGC | 155 bp | |
TGGGTGGAATCTCGTCTGGA | CGTAGAGGGCGGTTGAAAGAT | 132 bp | |
TTCGCTGTCCACAAGAACCAT | TAACTTTTGCTCCGAGGCCC | 131 bp | |
CCACGTCCAGTTAAGCAAAAGG | AGCGAAGCACTTCTTTCCGA | 147 bp | |
TGCGACATTGATATCCGTAAGG | GGTGGTTCCTCCGGAAAGAA | 60 bp |
Strains utilized:
Strain Name | Genotype | Source |
wild-type | CGC | |
Hekimi lab | ||
Genetic cross |
The HIF-1-mediated hypoxia pathway is a pathway of cellular resilience that is activated under conditions of low oxygen (hypoxia). The transcriptional changes for this pathway are mediated by the HIF-1 transcription factor, which acts in a heterodimer with AHA-1. hif-1 encodes the HIF-1α subunit, which is sensitive to oxygen levels, while aha-1 encodes the constitutively expressed HIF-1β subunit. Under normoxic conditions, HIF-1 is hydroxylated by the prolyl hydroxylase EGL-9 (Epstein et al., 2001). Hydroxylated HIF-1 can then be recognized by the von Hippel-Lindau E3 ubiquitin ligase VHL-1, resulting in ubiquitination and proteasomal degradation of HIF-1 (Bishop et al., 2004). Under hypoxic conditions (0.1% - 1% oxygen), there are insufficient levels of oxygen for EGL-9 to hydroxylate HIF-1. As a result, HIF-1 is not hydroxylated and not marked for degradation by VHL-1. Instead, HIF-1 is able to accumulate in the nucleus and induce changes in gene expression. HIF-1 can also escape degradation when either EGL-9 or VHL-1 are disrupted. In addition, HIF-1 degradation can be prevented by disrupting the RHY-1 (Regulator of hypoxia-inducible factor-1) transmembrane protein, which normally acts to reduce CYSL-1 levels and prevent CYSL-1 from binding to and inhibiting EGL-9 (Kruempel et al., 2020; Shen et al., 2006).
A number of previous studies have demonstrated a role for the HIF-1-mediated hypoxia response in lifespan determination. Increasing the levels or activation of HIF-1 either directly or through disruption of its negative regulators vhl-1, egl-9, or rhy-1, extends lifespan, indicating that activation of the hypoxia pathway can promote longevity (Kruempel et al., 2020; Leiser et al., 2015; Mehta et al., 2009; Zhang et al., 2009). In contrast, the results of studies examining the effects of hif-1 disruption on lifespan have been more varied with some experiments showing increased, decreased, or unchanged lifespan depending on the exact conditions utilized (Leiser and Kaeberlein, 2010). HIF-1 has also been shown to contribute to the longevity of multiple long-lived mutants. HIF-1 is required for lifespan extension in the long-lived mitochondrial mutants clk-1, isp-1 and nuo-6 (Lee et al., 2010; Wu et al., 2018), but dispensable for the enhanced longevity of daf-2, eat-2, glp-1 and osm-5 mutants (Lee et al., 2010; Soo et al., 2023). The HIF-1 target gene fmo-2 is required for the lifespan extension induced by dietary restriction and by mild mitochondrial dysfunction (Leiser et al., 2015; Van Raamsdonk, 2026).
Multiple previous studies have used RNA sequencing (RNA-seq) to find genes that are differentially expressed following HIF-1 activation. Although the expression of these genes is dependent on HIF-1, the effect of HIF-1 on gene expression could either be direct through HIF-1 binding to the promoter or indirect. As a result, we refer to these genes as HIF-1 modulated genes, though at least some of these genes are direct targets of HIF-1.
Shen et al. identified genes that are upregulated during hypoxia with p<0.05 and fold change greater than or equal to 2 and not upregulated by hypoxia in hif-1(ia4) mutants (Shen et al., 2005). Vora et al. identified genes that are upregulated in egl-9(sa307) and egl-9(sa307);hif-1(ia4):odIs131[hif-1::gfp] mutants compared to wild-type and egl-9;hif-1(ia4) worms (Vora et al., 2022). Feng et al. identified genes that are induced by 1.6 fold more in wild-type worms compared to hif-1(ia4) worms after a 2 hour exposure to hypoxia (Feng et al., 2024b). In a separate paper, Feng et al. identified genes upregulated in vhl-1(ok161), rhy-1(ok1402), egl-9(sa307) and swan-1(ok267);vhl-1(ok161) worms and made a list of genes commonly upregulated amongst all four strains (Feng et al., 2024a). Doering et al. identified genes upregulated by hypoxia in wild-type worms and nhr-49 mutants but not in hif-1 mutants (Doering et al., 2022). We previously compared gene expression between isp-1 and isp-1;hif-1 mutants, as the HIF-1-mediated hypoxia pathway has been found to be activated in isp-1 mutants (Lee et al., 2010). For our study, HIF-1 modulate genes were selected as genes that are upregulated by at least 30% in isp-1 worms compared to wild-type worms and decreased by at least 30% in isp-1;hif-1 worms compared to isp-1 worms.
In addition to these RNA-seq experiments, two studies have used Chromatin Immunoprecipitation sequencing (ChIP-seq) to find which gene promoters are bound by HIF-1 following activation. Feng et al. performed a ChIP-Seq experiment in which the hif-1a isoform was labelled with a HA tag in the egl-9(sa307) background and an anti-HA antibody was used for ChIP (Feng et al., 2024b). Vora et al. performed a ChIP-Seq experiment in which egl-9(sa307);hif-1(ia4);odIs131[hif-1::gfp] worms were compared to hif-1(ia4);odIs131[hif-1::gfp] worms (Vora et al., 2022).
To identify high confidence HIF-1 modulated genes, we initially compared the gene sets identified by Shen et al. (genes upregulated during hypoxia in a hif-1-dependent manner), Vora et al. (genes upregulated by egl-9 mutation in a hif-1-dependent manner) and Feng et al. (genes induced 1.6 fold more in wild-type worms than hif-1 worms after hypoxia) (Figure 1B). We found that there were 41 genes in at least two of these gene sets with just 8 genes found in all three. We then examined whether these 41 genes were identified in the other RNA-seq experiments and the published ChIP-Seq experiments. We found that three genes were identified in seven of the eight studies (Extended data Table S1) (The ChIP-seq experiment by Feng et al. only identified one of the 41 genes). This included egl-9, F22B5.4 and sqrd-1. There were 8 more genes that were identified in six of the eight studies: efk-1, phy-2, cysl-2, gbh-2, ethe-1, mce-1, ZK550.6, and pck-1.
As we have previously used RNA sequencing to examine gene expression in nuo-6 and nuo-6;hif-1 worms, as well as wild-type and hif-1 worms (Wu et al., 2018), we next examined the expression of a selection of these genes using this RNA-seq data. We found that disruption of hif-1 significantly decreased the expression of F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1, thereby providing additional support that these genes are dependent on HIF-1 (Figure 1C).
We recently examined gene expression in a panel of nine long-lived mutants representing multiple different pathways of lifespan extension (Rudich et al., 2026). To determine the extent to which the HIF-1-hypoxia pathway is activated in each of these strains, we examined the expression of HIF-1 modulated genes that were identified by at least four of the eight studies we examined. We found that nuo-6 and isp-1 showed the greatest activation of HIF-1 modulated genes, while osm-5 and eat-2 worms showed the least activation (Figure 1D). This is consistent with our observation that nuo-6 and isp-1 belong to a different longevity group than osm-5 and eat-2 worms, based on gene expression (Rudich et al., 2026). It is important to note that the expression of these HIF-1 modulated genes was examined at day 1 of adulthood. In addition to genotype, the transcriptional output of HIF-1 may vary by developmental stage, tissue, oxygen level, exposure duration and environmental stressors.
In order to facilitate other researchers quantifying the expression of HIF-1 target genes to measure activation of the HIF-1-hypoxia response, we designed primers to measure six of the high confidence HIF-1 target genes using quantitative RT-PCR (details on the binding location and amplicon size of the primers can be found in Extended data File 1). These genes included egl-9, F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1. To test the function of these primers, we isolated RNA from isp-1 and isp-1;hif-1 worms with wild-type worms as control. We normalized the expression of each gene to act-3, as our previous RNA-seq data showed that act-3 levels are not significantly different between wild-type and isp-1 worms. As anticipated, we found that the expression of all six selected HIF-1 target genes is upregulated in isp-1 mutants and the upregulation of these genes in isp-1 worms is completely prevented by the disruption of hif-1 (Figure 1E). This confirms that the primers we designed can be used to effectively measure the expression levels of these HIF-1 modulated genes.
Overall, this work combined multiple previous RNA-seq and ChIP-seq studies to identify high confidence HIF-1 target genes that can be used to monitor the activation of the HIF-1-mediated hypoxia response. We also designed and validated qPCR primers to quantify these genes using quantitative RT-PCR.
Bishop T, Lau KW, Epstein ACR, Kim SK, Jiang M, O'Rourke D, et al., Ratcliffe. 2004. Genetic Analysis of Pathways Regulated by the von Hippel-Lindau Tumor Suppressor in Caenorhabditis elegans. PLoS Biology 2: e289.
","pubmedId":"","doi":"10.1371/journal.pbio.0020289"},{"reference":"Doering KR, Cheng X, Milburn L, Ratnappan R, Ghazi A, Miller DL, Taubert S. 2022. Nuclear hormone receptor NHR-49 acts in parallel with HIF-1 to promote hypoxia adaptation in Caenorhabditis elegans. eLife 11: 10.7554/elife.67911.
","pubmedId":"","doi":"10.7554/eLife.67911"},{"reference":"Epstein ACR, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR, et al., Ratcliffe. 2001. C. elegans EGL-9 and Mammalian Homologs Define a Family of Dioxygenases that Regulate HIF by Prolyl Hydroxylation. Cell 107: 43-54.
","pubmedId":"","doi":"10.1016/s0092-8674(01)00507-4"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Whole genome profiling of short-term hypoxia induced genes and identification of HIF-1 binding sites provide insights into HIF-1 function in Caenorhabditis elegans. PLOS ONE 19: e0295094.
","pubmedId":"","doi":"10.1371/journal.pone.0295094"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Transcriptome analyses describe the consequences of persistent HIF-1 over-activation in Caenorhabditis elegans. PLOS ONE 19: e0295093.
","pubmedId":"","doi":"10.1371/journal.pone.0295093"},{"reference":"Kruempel JCP, Miller HA, Schaller ML, Fretz A, Howington M, Sarker M, Huang S, Leiser SF. 2020. Hypoxic response regulators RHY-1 and EGL-9/PHD promote longevity through a VHL-1-independent transcriptional response. GeroScience 42: 1621-1633.
","pubmedId":"","doi":"10.1007/s11357-020-00194-0"},{"reference":"Lee SJ, Hwang AB, Kenyon C. 2010. Inhibition of Respiration Extends C. elegans Life Span via Reactive Oxygen Species that Increase HIF-1 Activity. Current Biology 20: 2131-2136.
","pubmedId":"","doi":"10.1016/j.cub.2010.10.057"},{"reference":"Leiser SF, Kaeberlein M. 2010. The hypoxia-inducible factor HIF-1 functions as both a positive and negative modulator of aging. Biological Chemistry 391: 10.1515/bc.2010.123.
","pubmedId":"","doi":"10.1515/BC.2010.123"},{"reference":"Leiser SF, Miller H, Rossner R, Fletcher M, Leonard A, Primitivo M, et al., Kaeberlein. 2015. Cell nonautonomous activation of flavin-containing monooxygenase promotes longevity and health span. Science 350: 1375-1378.
","pubmedId":"","doi":"10.1126/science.aac9257"},{"reference":"Mehta R, Steinkraus KA, Sutphin GL, Ramos FJ, Shamieh LS, Huh A, et al., Kaeberlein. 2009. Proteasomal Regulation of the Hypoxic Response Modulates Aging in\n C. elegans. Science 324: 1196-1198.
","pubmedId":"","doi":"10.1126/science.1173507"},{"reference":"Rudich ZD, Guan J, Tamez Gonzalez AA, Booth GF, Soo SK, Anglas U, et al., Van Raamsdonk. 2026. Multiple molecular pathways to longevity with opposing gene expression programs defining distinct aging strategies in Caenorhabditis elegans. eLife 15: 10.7554/elife.112139.3.
","pubmedId":"","doi":"10.7554/eLife.112139.3"},{"reference":"Shen C, Nettleton D, Jiang M, Kim SK, Powell-Coffman JA. 2005. Roles of the HIF-1 Hypoxia-inducible Factor during Hypoxia Response in Caenorhabditis elegans. Journal of Biological Chemistry 280: 20580-20588.
","pubmedId":"","doi":"10.1074/jbc.M501894200"},{"reference":"Shen C, Shao Z, Powell-Coffman JA. 2006. The Caenorhabditis elegans rhy-1 Gene Inhibits HIF-1 Hypoxia-Inducible Factor Activity in a Negative Feedback Loop That Does Not Include vhl-1. Genetics 174: 1205-1214.
","pubmedId":"","doi":"10.1534/genetics.106.063594"},{"reference":"Soo SK, Rudich ZD, Ko B, Moldakozhayev A, AlOkda A, Van Raamsdonk JM. 2023. Biological resilience and aging: Activation of stress response pathways contributes to lifespan extension. Ageing Research Reviews 88: 101941.
","pubmedId":"","doi":"10.1016/j.arr.2023.101941"},{"reference":"Van Raamsdonk JM. 2026. Mild mitochondrial impairment activates overlapping longevity pathways converging on the flavin-containing monooxygenase FMO-2. Frontiers in Aging 7: 10.3389/fragi.2026.1808540.
","pubmedId":"","doi":"10.3389/fragi.2026.1808540"},{"reference":"Vora M, Pyonteck SM, Popovitchenko T, Matlack TL, Prashar A, Kane NS, et al., Rongo. 2022. The hypoxia response pathway promotes PEP carboxykinase and gluconeogenesis in C. elegans. Nature Communications 13: 10.1038/s41467-022-33849-x.
","pubmedId":"","doi":"10.1038/s41467-022-33849-x"},{"reference":"Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, et al., Van Raamsdonk. 2018. Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways. BMC Biology 16: 10.1186/s12915-018-0615-3.
","pubmedId":"","doi":"10.1186/s12915-018-0615-3"},{"reference":"Zhang Y, Shao Z, Zhai Z, Shen C, Powell-Coffman JA. 2009. The HIF-1 Hypoxia-Inducible Factor Modulates Lifespan in C. elegans. PLoS ONE 4: e6348.
","pubmedId":"","doi":"10.1371/journal.pone.0006348"}],"title":"High confidence HIF-1 target genes for quantifying the activation of the HIF-1-mediated hypoxia response
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1789434094462"}]},{"id":"fd76879e-cf25-48ab-ab76-718e6777812b","decision":"edit","abstract":"The hypoxia-inducible factor 1 (HIF-1)-mediated hypoxia response is an evolutionarily conserved stress response that enables adaptation to conditions of low oxygen and mitochondrial dysfunction. This pathway has been shown to affect both stress resistance and longevity. HIF-1 activity is regulated by EGL-9, VHL-1, and RHY-1 and induces the expression of genes involved in metabolism and cellular resilience. To find genes that can be used to monitor HIF-1 activation, we compared HIF-1 modulated genes identified by multiple RNA-seq experiments and HIF-1 target genes identified by ChIP-seq experiments. We identified high-confidence HIF-1 target genes that provide robust markers of pathway activation.
","acknowledgements":"
Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"camille.desnos@mail.mcgill.ca","firstName":"Camille AH","lastName":"Desnos","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"aura.tamezgonzalez@mail.mcgill.ca","firstName":"Aura A","lastName":"Tamez Gonzalez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, Quebec, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["conceptualization","formalAnalysis","investigation","methodology","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"jeremy.vanraamsdonk@mcgill.ca","firstName":"Jeremy M","lastName":"Van Raamsdonk","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0001-8376-9605"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table S1
","doi":"10.22002/5tjm5-nh142","resourceType":"Dataset","name":"Table S1 HIF-1.xlsx","url":"https://portal.micropublication.org/uploads/40af01cad2b86117b492df19744fab6a.xlsx"},{"description":"Extended Data File 1. Binding location and amplicon sizes of qPCR primers.
","doi":"10.22002/gm1q8-v4b87","resourceType":"Text","name":"qPCR Primers.docx","url":"https://portal.micropublication.org/uploads/8214477323886a4c58615ef9baa7d287.docx"}],"funding":"This work was supported by the Canadian Institutes of Health Research (CIHR; http://www.cihr-irsc.gc.ca/; JVR) and the Natural Sciences and Engineering Research Council of Canada (NSERC; https://www.nserc-crsng.gc.ca/index_eng.asp; JVR). JVR received a Senior Research Scholar career award from the Fonds de Recherche du Quebec Santé (FRQS) and Parkinson Quebec. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
","image":{"url":"https://portal.micropublication.org/uploads/2c0b823d7a5e7611a52f6e73ab98fec0.jpg"},"imageCaption":"(A) Overview of HIF-1 mediated hypoxia pathway. Under normal oxygen conditions (normoxia) HIF-1 is hydroxylated by EGL-9. Hydroxylated HIF-1 is recognized and ubiquitinated by VHL-1 (Ub = ubiquitin groups). Ubiquitinated HIF-1 is degraded by the proteasome. Under hypoxic conditions, EGL-9 cannot hydroxylate HIF-1. As a result, HIF-1 travels to the nucleus to change gene expression with AHA-1. (B) Weighted Venn diagram showing overlap of HIF-1 modulated genes identified by Shen et al., Feng et al. and Vora et al. using RNA-seq. (C) Expression of HIF-1 target genes in nuo-6 and nuo-6;hif-1 mutants from RNA-seq data. (D) Heat map showing expression of top HIF-1 modulated genes in a panel of nine long-lived mutants. Expression is indicated as a percentage of wild-type expression. The heatmap was generated using Morpheus: https://software.broadinstitute.org/morpheus/ The greatest number of HIF-1 modulated genes are activated in nuo-6 and isp-1 mitochondrial mutants, while the fewest are activated in osm-5 and eat-2 mutants. RNA-seq data for the heat map is from Rudich et al. 2026, eLife. The RNA-seq data is available at NCBI GEO: GSE179825, GSE93724, GSE110984. (E) The expression levels of high confidence HIF-1 target genes in isp-1 and isp-1;hif-1 mutants using qPCR. Expression levels were normalized to act-3 and then expressed as a percentage of wild-type expression. Statistical significance was determined using a two-way ANOVA with Šidák's multiple comparisons test in panel C and a one-way ANOVA with Dunnett's multiple comparisons test in panel E. ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
","imageTitle":"
Identification of high confidence HIF-1 target genes
","methods":"Strains
The following strains were used: N2 (wild-type), isp-1(qm150), isp-1(qm150);hif-1(ia4). Strains were maintained at 20°C on NGM plates seeded with OP50 E. coli bacteria.
RNA Isolation
Worms were synchronized by a 4-hour limited time egg laying, collected at the pre-fertile young adult stage, and washed 3 times with M9. Trizol was then added and the samples were frozen in liquid nitrogen and kept at –80°C until RNA isolation. To extract the RNA, the pellet was thawed and re-frozen in liquid nitrogen 3 times, after which more Trizol was added to a total volume of 250 µl. This was followed by 3 vortex cycles consisting of 30s vortexing and 30s at room temperature. Samples were then left to sit at room temperature for 15 minutes and chloroform was added at 1:5 volume of Trizol. After shaking for 15 seconds, samples were left to sit at room temperature for 3 minutes. Then, samples were centrifuged at 12,000 x g for 15 minutes at 4°C, and the upper aqueous phase was transferred to a new tube. An equal volume of isopropanol was added, and it was left sitting on ice for 1 hour. After, samples were centrifuged at 12,000 x g for 20 minutes at 4°C, the supernatant was removed, and the pellet was washed with 75% ethanol. Then, samples were centrifuged at 12,000 x g for 10 minutes at 4°C, the ethanol was removed, and 100% ethanol was added before centrifuging at 12,000 x g for 3 minutes. The ethanol was removed and the pellet was air dried for 5 minutes until no traces of ethanol were found. The pellet was then dissolved in RNAse free double distilled water. RNA was isolated from 3 biological replicates.
Quantitative PCR
The samples underwent DNase I treatment to remove genomic DNA, using a DNase I, RNase-free kit (Thermo Scientific) following the manufacturer's instructions. Then, cDNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems), according to the manufacturer's protocol. qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a Viia7 Real Time PCR System (Applied Biosystems). RNA levels were normalized to the expression of the act-3 gene. After running the RT-PCR, expression levels were calculated as 2-CT (CT is the cycle threshold, which is the number of cycles at which time the fluorescence crosses a specified threshold). The expression levels for each individual gene was then divided by the expression level of the control gene act-3. Finally, the copies/copy act-3 was divided by the average copies/copy act-3 of the wild-type samples. Three biological replicates were performed.
Primers
The sequences for the primers used for qPCR are below:
Gene | Primer 1 | Primer 2 | Amplicon Size |
TCGACAACCCTCCAAGAACA | GGCTTCTGATCACATGCTCG | 115 bp | |
ATGTTCCATCGCCAGCAAGA | ACGGCGGACAAGGAATTGATA | 146 bp | |
TGGTGGGTCATTACAGTCCAAA | TACATGGCCGATTACCCTGC | 155 bp | |
TGGGTGGAATCTCGTCTGGA | CGTAGAGGGCGGTTGAAAGAT | 132 bp | |
TTCGCTGTCCACAAGAACCAT | TAACTTTTGCTCCGAGGCCC | 131 bp | |
CCACGTCCAGTTAAGCAAAAGG | AGCGAAGCACTTCTTTCCGA | 147 bp | |
TGCGACATTGATATCCGTAAGG | GGTGGTTCCTCCGGAAAGAA | 60 bp |
Strains utilized:
Strain Name | Genotype | Source |
wild-type | CGC | |
Hekimi lab | ||
Genetic cross |
The HIF-1-mediated hypoxia pathway is a pathway of cellular resilience that is activated under conditions of low oxygen (hypoxia). The transcriptional changes for this pathway are mediated by the HIF-1 transcription factor, which acts in a heterodimer with AHA-1. hif-1 encodes the HIF-1α subunit, which is sensitive to oxygen levels, while aha-1 encodes the constitutively expressed HIF-1β subunit. Under normoxic conditions, HIF-1 is hydroxylated by the prolyl hydroxylase EGL-9 (Epstein et al., 2001). Hydroxylated HIF-1 can then be recognized by the von Hippel-Lindau E3 ubiquitin ligase VHL-1, resulting in ubiquitination and proteasomal degradation of HIF-1 (Bishop et al., 2004). Under hypoxic conditions (0.1% - 1% oxygen), there are insufficient levels of oxygen for EGL-9 to hydroxylate HIF-1. As a result, HIF-1 is not hydroxylated and not marked for degradation by VHL-1. Instead, HIF-1 is able to accumulate in the nucleus and induce changes in gene expression. HIF-1 can also escape degradation when either EGL-9 or VHL-1 are disrupted. In addition, HIF-1 degradation can be prevented by disrupting the RHY-1 (Regulator of hypoxia-inducible factor-1) transmembrane protein, which normally acts to reduce CYSL-1 levels and prevent CYSL-1 from binding to and inhibiting EGL-9 (Kruempel et al., 2020; Shen et al., 2006).
A number of previous studies have demonstrated a role for the HIF-1-mediated hypoxia response in lifespan determination. Increasing the levels or activation of HIF-1 either directly or through disruption of its negative regulators vhl-1, egl-9, or rhy-1, extends lifespan, indicating that activation of the hypoxia pathway can promote longevity (Kruempel et al., 2020; Leiser et al., 2015; Mehta et al., 2009; Zhang et al., 2009). In contrast, the results of studies examining the effects of hif-1 disruption on lifespan have been more varied with some experiments showing increased, decreased, or unchanged lifespan depending on the exact conditions utilized (Leiser and Kaeberlein, 2010). HIF-1 has also been shown to contribute to the longevity of multiple long-lived mutants. HIF-1 is required for lifespan extension in the long-lived mitochondrial mutants clk-1, isp-1 and nuo-6 (Lee et al., 2010; Wu et al., 2018), but dispensable for the enhanced longevity of daf-2, eat-2, glp-1 and osm-5 mutants (Lee et al., 2010; Soo et al., 2023). The HIF-1 target gene fmo-2 is required for the lifespan extension induced by dietary restriction and by mild mitochondrial dysfunction (Leiser et al., 2015; Van Raamsdonk, 2026).
Multiple previous studies have used RNA sequencing (RNA-seq) to find genes that are differentially expressed following HIF-1 activation. Although the expression of these genes is dependent on HIF-1, the effect of HIF-1 on gene expression could either be direct through HIF-1 binding to the promoter or indirect. As a result, we refer to these genes as HIF-1 modulated genes, though at least some of these genes are direct targets of HIF-1.
Shen et al. identified genes that are upregulated during hypoxia with p<0.05 and fold change greater than or equal to 2 and not upregulated by hypoxia in hif-1(ia4) mutants (Shen et al., 2005). Vora et al. identified genes that are upregulated in egl-9(sa307) and egl-9(sa307);hif-1(ia4):odIs131[hif-1::gfp] mutants compared to wild-type and egl-9;hif-1(ia4) worms (Vora et al., 2022). Feng et al. identified genes that are induced by 1.6 fold more in wild-type worms compared to hif-1(ia4) worms after a 2 hour exposure to hypoxia (Feng et al., 2024b). In a separate paper, Feng et al. identified genes upregulated in vhl-1(ok161), rhy-1(ok1402), egl-9(sa307) and swan-1(ok267);vhl-1(ok161) worms and made a list of genes commonly upregulated amongst all four strains (Feng et al., 2024a). Doering et al. identified genes upregulated by hypoxia in wild-type worms and nhr-49 mutants but not in hif-1 mutants (Doering et al., 2022). We previously compared gene expression between isp-1 and isp-1;hif-1 mutants, as the HIF-1-mediated hypoxia pathway has been found to be activated in isp-1 mutants (Lee et al., 2010). For our study, HIF-1 modulated genes were selected as genes that are upregulated by at least 30% in isp-1 worms compared to wild-type worms and decreased by at least 30% in isp-1;hif-1 worms compared to isp-1 worms.
In addition to these RNA-seq experiments, two studies have used Chromatin Immunoprecipitation sequencing (ChIP-seq) to find which gene promoters are bound by HIF-1 following activation. Feng et al. performed a ChIP-Seq experiment in which the hif-1a isoform was labelled with a HA tag in the egl-9(sa307) background and an anti-HA antibody was used for ChIP (Feng et al., 2024b). Vora et al. performed a ChIP-Seq experiment in which egl-9(sa307);hif-1(ia4);odIs131[hif-1::gfp] worms were compared to hif-1(ia4);odIs131[hif-1::gfp] worms (Vora et al., 2022).
To identify high confidence HIF-1 modulated genes, we initially compared the gene sets identified by Shen et al. (genes upregulated during hypoxia in a hif-1-dependent manner), Vora et al. (genes upregulated by egl-9 mutation in a hif-1-dependent manner) and Feng et al. (genes induced 1.6 fold more in wild-type worms than hif-1 worms after hypoxia) (Figure 1B). We found that there were 41 genes in at least two of these gene sets with just 8 genes found in all three. We then examined whether these 41 genes were identified in the other RNA-seq experiments and the published ChIP-Seq experiments. We found that three genes were identified in seven of the eight studies (Extended data Table S1) (The ChIP-seq experiment by Feng et al. only identified one of the 41 genes). This included egl-9, F22B5.4 and sqrd-1. There were 8 more genes that were identified in six of the eight studies: efk-1, phy-2, cysl-2, gbh-2, ethe-1, mce-1, ZK550.6, and pck-1.
As we have previously used RNA sequencing to examine gene expression in nuo-6 and nuo-6;hif-1 worms, as well as wild-type and hif-1 worms (Wu et al., 2018), we next examined the expression of a selection of these genes using this RNA-seq data. We found that disruption of hif-1 significantly decreased the expression of F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1, thereby providing additional support that these genes are dependent on HIF-1 (Figure 1C).
We recently examined gene expression in a panel of nine long-lived mutants representing multiple different pathways of lifespan extension (Rudich et al., 2026). To determine the extent to which the HIF-1-hypoxia pathway is activated in each of these strains, we examined the expression of HIF-1 modulated genes that were identified by at least four of the eight studies we examined. We found that nuo-6 and isp-1 showed the greatest activation of HIF-1 modulated genes, while osm-5 and eat-2 worms showed the least activation (Figure 1D). This is consistent with our observation that nuo-6 and isp-1 belong to a different longevity group than osm-5 and eat-2 worms, based on gene expression (Rudich et al., 2026). It is important to note that the expression of these HIF-1 modulated genes was examined at day 1 of adulthood. In addition to genotype, the transcriptional output of HIF-1 may vary by developmental stage, tissue, oxygen level, exposure duration and environmental stressors.
In order to facilitate other researchers quantifying the expression of HIF-1 target genes to measure activation of the HIF-1-hypoxia response, we designed primers to measure six of the high confidence HIF-1 target genes using quantitative RT-PCR (details on the binding location and amplicon size of the primers can be found in Extended data File 1). These genes included egl-9, F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1. To test the function of these primers, we isolated RNA from isp-1 and isp-1;hif-1 worms with wild-type worms as control. We normalized the expression of each gene to act-3, as our previous RNA-seq data showed that act-3 levels are not significantly different between wild-type and isp-1 worms. As anticipated, we found that the expression of all six selected HIF-1 target genes is upregulated in isp-1 mutants and the upregulation of these genes in isp-1 worms is completely prevented by the disruption of hif-1 (Figure 1E). This confirms that the primers we designed can be used to effectively measure the expression levels of these HIF-1 target genes.
Overall, this work combined multiple previous RNA-seq and ChIP-seq studies to identify high confidence HIF-1 target genes that can be used to monitor the activation of the HIF-1-mediated hypoxia response. We also designed and validated qPCR primers to quantify these genes using quantitative RT-PCR.
Bishop T, Lau KW, Epstein ACR, Kim SK, Jiang M, O'Rourke D, et al., Ratcliffe. 2004. Genetic Analysis of Pathways Regulated by the von Hippel-Lindau Tumor Suppressor in Caenorhabditis elegans. PLoS Biology 2: e289.
","pubmedId":"","doi":"10.1371/journal.pbio.0020289"},{"reference":"Doering KR, Cheng X, Milburn L, Ratnappan R, Ghazi A, Miller DL, Taubert S. 2022. Nuclear hormone receptor NHR-49 acts in parallel with HIF-1 to promote hypoxia adaptation in Caenorhabditis elegans. eLife 11: 10.7554/elife.67911.
","pubmedId":"","doi":"10.7554/eLife.67911"},{"reference":"Epstein ACR, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR, et al., Ratcliffe. 2001. C. elegans EGL-9 and Mammalian Homologs Define a Family of Dioxygenases that Regulate HIF by Prolyl Hydroxylation. Cell 107: 43-54.
","pubmedId":"","doi":"10.1016/s0092-8674(01)00507-4"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Whole genome profiling of short-term hypoxia induced genes and identification of HIF-1 binding sites provide insights into HIF-1 function in Caenorhabditis elegans. PLOS ONE 19: e0295094.
","pubmedId":"","doi":"10.1371/journal.pone.0295094"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Transcriptome analyses describe the consequences of persistent HIF-1 over-activation in Caenorhabditis elegans. PLOS ONE 19: e0295093.
","pubmedId":"","doi":"10.1371/journal.pone.0295093"},{"reference":"Kruempel JCP, Miller HA, Schaller ML, Fretz A, Howington M, Sarker M, Huang S, Leiser SF. 2020. Hypoxic response regulators RHY-1 and EGL-9/PHD promote longevity through a VHL-1-independent transcriptional response. GeroScience 42: 1621-1633.
","pubmedId":"","doi":"10.1007/s11357-020-00194-0"},{"reference":"Lee SJ, Hwang AB, Kenyon C. 2010. Inhibition of Respiration Extends C. elegans Life Span via Reactive Oxygen Species that Increase HIF-1 Activity. Current Biology 20: 2131-2136.
","pubmedId":"","doi":"10.1016/j.cub.2010.10.057"},{"reference":"Leiser SF, Kaeberlein M. 2010. The hypoxia-inducible factor HIF-1 functions as both a positive and negative modulator of aging. Biological Chemistry 391: 10.1515/bc.2010.123.
","pubmedId":"","doi":"10.1515/BC.2010.123"},{"reference":"Leiser SF, Miller H, Rossner R, Fletcher M, Leonard A, Primitivo M, et al., Kaeberlein. 2015. Cell nonautonomous activation of flavin-containing monooxygenase promotes longevity and health span. Science 350: 1375-1378.
","pubmedId":"","doi":"10.1126/science.aac9257"},{"reference":"Mehta R, Steinkraus KA, Sutphin GL, Ramos FJ, Shamieh LS, Huh A, et al., Kaeberlein. 2009. Proteasomal Regulation of the Hypoxic Response Modulates Aging in\n C. elegans. Science 324: 1196-1198.
","pubmedId":"","doi":"10.1126/science.1173507"},{"reference":"Rudich ZD, Guan J, Tamez Gonzalez AA, Booth GF, Soo SK, Anglas U, et al., Van Raamsdonk. 2026. Multiple molecular pathways to longevity with opposing gene expression programs defining distinct aging strategies in Caenorhabditis elegans. eLife 15: 10.7554/elife.112139.3.
","pubmedId":"","doi":"10.7554/eLife.112139.3"},{"reference":"Shen C, Nettleton D, Jiang M, Kim SK, Powell-Coffman JA. 2005. Roles of the HIF-1 Hypoxia-inducible Factor during Hypoxia Response in Caenorhabditis elegans. Journal of Biological Chemistry 280: 20580-20588.
","pubmedId":"","doi":"10.1074/jbc.M501894200"},{"reference":"Shen C, Shao Z, Powell-Coffman JA. 2006. The Caenorhabditis elegans rhy-1 Gene Inhibits HIF-1 Hypoxia-Inducible Factor Activity in a Negative Feedback Loop That Does Not Include vhl-1. Genetics 174: 1205-1214.
","pubmedId":"","doi":"10.1534/genetics.106.063594"},{"reference":"Soo SK, Rudich ZD, Ko B, Moldakozhayev A, AlOkda A, Van Raamsdonk JM. 2023. Biological resilience and aging: Activation of stress response pathways contributes to lifespan extension. Ageing Research Reviews 88: 101941.
","pubmedId":"","doi":"10.1016/j.arr.2023.101941"},{"reference":"Van Raamsdonk JM. 2026. Mild mitochondrial impairment activates overlapping longevity pathways converging on the flavin-containing monooxygenase FMO-2. Frontiers in Aging 7: 10.3389/fragi.2026.1808540.
","pubmedId":"","doi":"10.3389/fragi.2026.1808540"},{"reference":"Vora M, Pyonteck SM, Popovitchenko T, Matlack TL, Prashar A, Kane NS, et al., Rongo. 2022. The hypoxia response pathway promotes PEP carboxykinase and gluconeogenesis in C. elegans. Nature Communications 13: 10.1038/s41467-022-33849-x.
","pubmedId":"","doi":"10.1038/s41467-022-33849-x"},{"reference":"Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, et al., Van Raamsdonk. 2018. Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways. BMC Biology 16: 10.1186/s12915-018-0615-3.
","pubmedId":"","doi":"10.1186/s12915-018-0615-3"},{"reference":"Zhang Y, Shao Z, Zhai Z, Shen C, Powell-Coffman JA. 2009. The HIF-1 Hypoxia-Inducible Factor Modulates Lifespan in C. elegans. PLoS ONE 4: e6348.
","pubmedId":"","doi":"10.1371/journal.pone.0006348"}],"title":"High confidence HIF-1 target genes for quantifying the activation of the HIF-1-mediated hypoxia response
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"eb252a8a-189d-4d3e-a60c-c38f00d36aa6","decision":"publish","abstract":"The hypoxia-inducible factor 1 (HIF-1)-mediated hypoxia response is an evolutionarily conserved stress response that enables adaptation to conditions of low oxygen and mitochondrial dysfunction. This pathway has been shown to affect both stress resistance and longevity. HIF-1 activity is regulated by EGL-9, VHL-1, and RHY-1 and induces the expression of genes involved in metabolism and cellular resilience. To find genes that can be used to monitor HIF-1 activation, we compared HIF-1 modulated genes identified by multiple RNA-seq experiments and HIF-1 target genes identified by ChIP-seq experiments. We identified high-confidence HIF-1 target genes that provide robust markers of pathway activation.
","acknowledgements":"
Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440).
","authors":[{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"camille.desnos@mail.mcgill.ca","firstName":"Camille AH","lastName":"Desnos","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, QC, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["formalAnalysis","investigation","methodology","validation","visualization","writing_reviewEditing"],"email":"aura.tamezgonzalez@mail.mcgill.ca","firstName":"Aura A","lastName":"Tamez Gonzalez","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":true,"WBId":null,"orcid":null},{"affiliations":["McGill University, Montreal, Quebec, Canada","Research Institute of the McGill University Health Centre"],"departments":["Neurology and Neurosurgery","Metabolic Disorders and Complications (MeDiC)"],"credit":["conceptualization","formalAnalysis","investigation","methodology","supervision","visualization","writing_originalDraft","writing_reviewEditing"],"email":"jeremy.vanraamsdonk@mcgill.ca","firstName":"Jeremy M","lastName":"Van Raamsdonk","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":null,"WBId":"","orcid":"0000-0001-8376-9605"}],"awards":[],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[{"description":"Extended Data Table S1
","doi":"10.22002/5tjm5-nh142","resourceType":"Dataset","name":"Table S1 HIF-1.xlsx","url":"https://portal.micropublication.org/uploads/40af01cad2b86117b492df19744fab6a.xlsx"},{"description":"Extended Data File 1. Binding location and amplicon sizes of qPCR primers.
","doi":"10.22002/gm1q8-v4b87","resourceType":"Text","name":"qPCR Primers.docx","url":"https://portal.micropublication.org/uploads/8214477323886a4c58615ef9baa7d287.docx"}],"funding":"This work was supported by the Canadian Institutes of Health Research (CIHR; http://www.cihr-irsc.gc.ca/; JVR) and the Natural Sciences and Engineering Research Council of Canada (NSERC; https://www.nserc-crsng.gc.ca/index_eng.asp; JVR). JVR received a Senior Research Scholar career award from the Fonds de Recherche du Quebec Santé (FRQS) and Parkinson Quebec. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
","image":{"url":"https://portal.micropublication.org/uploads/2c0b823d7a5e7611a52f6e73ab98fec0.jpg"},"imageCaption":"(A) Overview of HIF-1 mediated hypoxia pathway. Under normal oxygen conditions (normoxia) HIF-1 is hydroxylated by EGL-9. Hydroxylated HIF-1 is recognized and ubiquitinated by VHL-1 (Ub = ubiquitin groups). Ubiquitinated HIF-1 is degraded by the proteasome. Under hypoxic conditions, EGL-9 cannot hydroxylate HIF-1. As a result, HIF-1 travels to the nucleus to change gene expression with AHA-1. (B) Weighted Venn diagram showing overlap of HIF-1 modulated genes identified by Shen et al., Feng et al. and Vora et al. using RNA-seq. (C) Expression of HIF-1 target genes in nuo-6 and nuo-6;hif-1 mutants from RNA-seq data. (D) Heat map showing expression of top HIF-1 modulated genes in a panel of nine long-lived mutants. Expression is indicated as a percentage of wild-type expression. The heatmap was generated using Morpheus: https://software.broadinstitute.org/morpheus/ The greatest number of HIF-1 modulated genes are activated in nuo-6 and isp-1 mitochondrial mutants, while the fewest are activated in osm-5 and eat-2 mutants. RNA-seq data for the heat map is from Rudich et al. 2026, eLife. The RNA-seq data is available at NCBI GEO: GSE179825, GSE93724, GSE110984. (E) The expression levels of high confidence HIF-1 target genes in isp-1 and isp-1;hif-1 mutants using qPCR. Expression levels were normalized to act-3 and then expressed as a percentage of wild-type expression. Statistical significance was determined using a two-way ANOVA with Šidák's multiple comparisons test in panel C and a one-way ANOVA with Dunnett's multiple comparisons test in panel E. ns = not significant, *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.
","imageTitle":"
Identification of high confidence HIF-1 target genes
","methods":"Strains
The following strains were used: N2 (wild-type), isp-1(qm150), isp-1(qm150);hif-1(ia4). Strains were maintained at 20°C on NGM plates seeded with OP50 E. coli bacteria.
RNA Isolation
Worms were synchronized by a 4-hour limited time egg laying, collected at the pre-fertile young adult stage, and washed 3 times with M9. Trizol was then added and the samples were frozen in liquid nitrogen and kept at –80°C until RNA isolation. To extract the RNA, the pellet was thawed and re-frozen in liquid nitrogen 3 times, after which more Trizol was added to a total volume of 250 µl. This was followed by 3 vortex cycles consisting of 30s vortexing and 30s at room temperature. Samples were then left to sit at room temperature for 15 minutes and chloroform was added at 1:5 volume of Trizol. After shaking for 15 seconds, samples were left to sit at room temperature for 3 minutes. Then, samples were centrifuged at 12,000 x g for 15 minutes at 4°C, and the upper aqueous phase was transferred to a new tube. An equal volume of isopropanol was added, and it was left sitting on ice for 1 hour. After, samples were centrifuged at 12,000 x g for 20 minutes at 4°C, the supernatant was removed, and the pellet was washed with 75% ethanol. Then, samples were centrifuged at 12,000 x g for 10 minutes at 4°C, the ethanol was removed, and 100% ethanol was added before centrifuging at 12,000 x g for 3 minutes. The ethanol was removed and the pellet was air dried for 5 minutes until no traces of ethanol were found. The pellet was then dissolved in RNAse free double distilled water. RNA was isolated from 3 biological replicates.
Quantitative PCR
The samples underwent DNase I treatment to remove genomic DNA, using a DNase I, RNase-free kit (Thermo Scientific) following the manufacturer's instructions. Then, cDNA was synthesized using a High Capacity cDNA Reverse Transcription Kit (Applied Biosystems), according to the manufacturer's protocol. qPCR was performed using SYBR Green Master Mix (Applied Biosystems) in a Viia7 Real Time PCR System (Applied Biosystems). RNA levels were normalized to the expression of the act-3 gene. After running the RT-PCR, expression levels were calculated as 2-CT (CT is the cycle threshold, which is the number of cycles at which time the fluorescence crosses a specified threshold). The expression levels for each individual gene was then divided by the expression level of the control gene act-3. Finally, the copies/copy act-3 was divided by the average copies/copy act-3 of the wild-type samples. Three biological replicates were performed.
Primers
The sequences for the primers used for qPCR are below:
Gene | Primer 1 | Primer 2 | Amplicon Size |
TCGACAACCCTCCAAGAACA | GGCTTCTGATCACATGCTCG | 115 bp | |
ATGTTCCATCGCCAGCAAGA | ACGGCGGACAAGGAATTGATA | 146 bp | |
TGGTGGGTCATTACAGTCCAAA | TACATGGCCGATTACCCTGC | 155 bp | |
TGGGTGGAATCTCGTCTGGA | CGTAGAGGGCGGTTGAAAGAT | 132 bp | |
TTCGCTGTCCACAAGAACCAT | TAACTTTTGCTCCGAGGCCC | 131 bp | |
CCACGTCCAGTTAAGCAAAAGG | AGCGAAGCACTTCTTTCCGA | 147 bp | |
TGCGACATTGATATCCGTAAGG | GGTGGTTCCTCCGGAAAGAA | 60 bp |
Strains utilized:
Strain Name | Genotype | Source |
wild-type | CGC | |
Hekimi lab | ||
Genetic cross |
The HIF-1-mediated hypoxia pathway is a pathway of cellular resilience that is activated under conditions of low oxygen (hypoxia). The transcriptional changes for this pathway are mediated by the HIF-1 transcription factor, which acts in a heterodimer with AHA-1. hif-1 encodes the HIF-1α subunit, which is sensitive to oxygen levels, while aha-1 encodes the constitutively expressed HIF-1β subunit. Under normoxic conditions, HIF-1 is hydroxylated by the prolyl hydroxylase EGL-9 (Epstein et al., 2001). Hydroxylated HIF-1 can then be recognized by the von Hippel-Lindau E3 ubiquitin ligase VHL-1, resulting in ubiquitination and proteasomal degradation of HIF-1 (Bishop et al., 2004). Under hypoxic conditions (0.1% - 1% oxygen), there are insufficient levels of oxygen for EGL-9 to hydroxylate HIF-1. As a result, HIF-1 is not hydroxylated and not marked for degradation by VHL-1. Instead, HIF-1 is able to accumulate in the nucleus and induce changes in gene expression. HIF-1 can also escape degradation when either EGL-9 or VHL-1 are disrupted. In addition, HIF-1 degradation can be prevented by disrupting the RHY-1 (Regulator of hypoxia-inducible factor-1) transmembrane protein, which normally acts to reduce CYSL-1 levels and prevent CYSL-1 from binding to and inhibiting EGL-9 (Kruempel et al., 2020; Shen et al., 2006).
A number of previous studies have demonstrated a role for the HIF-1-mediated hypoxia response in lifespan determination. Increasing the levels or activation of HIF-1 either directly or through disruption of its negative regulators vhl-1, egl-9, or rhy-1, extends lifespan, indicating that activation of the hypoxia pathway can promote longevity (Kruempel et al., 2020; Leiser et al., 2015; Mehta et al., 2009; Zhang et al., 2009). In contrast, the results of studies examining the effects of hif-1 disruption on lifespan have been more varied with some experiments showing increased, decreased, or unchanged lifespan depending on the exact conditions utilized (Leiser and Kaeberlein, 2010). HIF-1 has also been shown to contribute to the longevity of multiple long-lived mutants. HIF-1 is required for lifespan extension in the long-lived mitochondrial mutants clk-1, isp-1 and nuo-6 (Lee et al., 2010; Wu et al., 2018), but dispensable for the enhanced longevity of daf-2, eat-2, glp-1 and osm-5 mutants (Lee et al., 2010; Soo et al., 2023). The HIF-1 target gene fmo-2 is required for the lifespan extension induced by dietary restriction and by mild mitochondrial dysfunction (Leiser et al., 2015; Van Raamsdonk, 2026).
Multiple previous studies have used RNA sequencing (RNA-seq) to find genes that are differentially expressed following HIF-1 activation. Although the expression of these genes is dependent on HIF-1, the effect of HIF-1 on gene expression could either be direct through HIF-1 binding to the promoter or indirect. As a result, we refer to these genes as HIF-1 modulated genes, though at least some of these genes are direct targets of HIF-1.
Shen et al. identified genes that are upregulated during hypoxia with p<0.05 and fold change greater than or equal to 2 and not upregulated by hypoxia in hif-1(ia4) mutants (Shen et al., 2005). Vora et al. identified genes that are upregulated in egl-9(sa307) and egl-9(sa307);hif-1(ia4):odIs131[hif-1::gfp] mutants compared to wild-type and egl-9;hif-1(ia4) worms (Vora et al., 2022). Feng et al. identified genes that are induced by 1.6 fold more in wild-type worms compared to hif-1(ia4) worms after a 2 hour exposure to hypoxia (Feng et al., 2024b). In a separate paper, Feng et al. identified genes upregulated in vhl-1(ok161), rhy-1(ok1402), egl-9(sa307) and swan-1(ok267);vhl-1(ok161) worms and made a list of genes commonly upregulated amongst all four strains (Feng et al., 2024a). Doering et al. identified genes upregulated by hypoxia in wild-type worms and nhr-49 mutants but not in hif-1 mutants (Doering et al., 2022). We previously compared gene expression between isp-1 and isp-1;hif-1 mutants, as the HIF-1-mediated hypoxia pathway has been found to be activated in isp-1 mutants (Lee et al., 2010). For our study, HIF-1 modulated genes were selected as genes that are upregulated by at least 30% in isp-1 worms compared to wild-type worms and decreased by at least 30% in isp-1;hif-1 worms compared to isp-1 worms.
In addition to these RNA-seq experiments, two studies have used Chromatin Immunoprecipitation sequencing (ChIP-seq) to find which gene promoters are bound by HIF-1 following activation. Feng et al. performed a ChIP-Seq experiment in which the hif-1a isoform was labelled with a HA tag in the egl-9(sa307) background and an anti-HA antibody was used for ChIP (Feng et al., 2024b). Vora et al. performed a ChIP-Seq experiment in which egl-9(sa307);hif-1(ia4);odIs131[hif-1::gfp] worms were compared to hif-1(ia4);odIs131[hif-1::gfp] worms (Vora et al., 2022).
To identify high confidence HIF-1 modulated genes, we initially compared the gene sets identified by Shen et al. (genes upregulated during hypoxia in a hif-1-dependent manner), Vora et al. (genes upregulated by egl-9 mutation in a hif-1-dependent manner) and Feng et al. (genes induced 1.6 fold more in wild-type worms than hif-1 worms after hypoxia) (Figure 1B). We found that there were 41 genes in at least two of these gene sets with just 8 genes found in all three. We then examined whether these 41 genes were identified in the other RNA-seq experiments and the published ChIP-Seq experiments. We found that three genes were identified in seven of the eight studies (Extended data Table S1) (The ChIP-seq experiment by Feng et al. only identified one of the 41 genes). This included egl-9, F22B5.4 and sqrd-1. There were 8 more genes that were identified in six of the eight studies: efk-1, phy-2, cysl-2, gbh-2, ethe-1, mce-1, ZK550.6, and pck-1.
As we have previously used RNA sequencing to examine gene expression in nuo-6 and nuo-6;hif-1 worms, as well as wild-type and hif-1 worms (Wu et al., 2018), we next examined the expression of a selection of these genes using this RNA-seq data. We found that disruption of hif-1 significantly decreased the expression of F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1, thereby providing additional support that these genes are dependent on HIF-1 (Figure 1C).
We recently examined gene expression in a panel of nine long-lived mutants representing multiple different pathways of lifespan extension (Rudich et al., 2026). To determine the extent to which the HIF-1-hypoxia pathway is activated in each of these strains, we examined the expression of HIF-1 modulated genes that were identified by at least four of the eight studies we examined. We found that nuo-6 and isp-1 showed the greatest activation of HIF-1 modulated genes, while osm-5 and eat-2 worms showed the least activation (Figure 1D). This is consistent with our observation that nuo-6 and isp-1 belong to a different longevity group than osm-5 and eat-2 worms, based on gene expression (Rudich et al., 2026). It is important to note that the expression of these HIF-1 modulated genes was examined at day 1 of adulthood. In addition to genotype, the transcriptional output of HIF-1 may vary by developmental stage, tissue, oxygen level, exposure duration and environmental stressors.
In order to facilitate other researchers quantifying the expression of HIF-1 target genes to measure activation of the HIF-1-hypoxia response, we designed primers to measure six of the high confidence HIF-1 target genes using quantitative RT-PCR (details on the binding location and amplicon size of the primers can be found in Extended data File 1). These genes included egl-9, F22B5.4, sqrd-1, cysl-2, mce-1 and pck-1. To test the function of these primers, we isolated RNA from isp-1 and isp-1;hif-1 worms with wild-type worms as control. We normalized the expression of each gene to act-3, as our previous RNA-seq data showed that act-3 levels are not significantly different between wild-type and isp-1 worms. As anticipated, we found that the expression of all six selected HIF-1 target genes is upregulated in isp-1 mutants and the upregulation of these genes in isp-1 worms is completely prevented by the disruption of hif-1 (Figure 1E). This confirms that the primers we designed can be used to effectively measure the expression levels of these HIF-1 target genes.
Overall, this work combined multiple previous RNA-seq and ChIP-seq studies to identify high confidence HIF-1 target genes that can be used to monitor the activation of the HIF-1-mediated hypoxia response. We also designed and validated qPCR primers to quantify these genes using quantitative RT-PCR.
Bishop T, Lau KW, Epstein ACR, Kim SK, Jiang M, O'Rourke D, et al., Ratcliffe. 2004. Genetic Analysis of Pathways Regulated by the von Hippel-Lindau Tumor Suppressor in Caenorhabditis elegans. PLoS Biology 2: e289.
","pubmedId":"","doi":"10.1371/journal.pbio.0020289"},{"reference":"Doering KR, Cheng X, Milburn L, Ratnappan R, Ghazi A, Miller DL, Taubert S. 2022. Nuclear hormone receptor NHR-49 acts in parallel with HIF-1 to promote hypoxia adaptation in Caenorhabditis elegans. eLife 11: 10.7554/elife.67911.
","pubmedId":"","doi":"10.7554/eLife.67911"},{"reference":"Epstein ACR, Gleadle JM, McNeill LA, Hewitson KS, O'Rourke J, Mole DR, et al., Ratcliffe. 2001. C. elegans EGL-9 and Mammalian Homologs Define a Family of Dioxygenases that Regulate HIF by Prolyl Hydroxylation. Cell 107: 43-54.
","pubmedId":"","doi":"10.1016/s0092-8674(01)00507-4"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Whole genome profiling of short-term hypoxia induced genes and identification of HIF-1 binding sites provide insights into HIF-1 function in Caenorhabditis elegans. PLOS ONE 19: e0295094.
","pubmedId":"","doi":"10.1371/journal.pone.0295094"},{"reference":"Feng D, Qu L, Powell-Coffman JA. 2024. Transcriptome analyses describe the consequences of persistent HIF-1 over-activation in Caenorhabditis elegans. PLOS ONE 19: e0295093.
","pubmedId":"","doi":"10.1371/journal.pone.0295093"},{"reference":"Kruempel JCP, Miller HA, Schaller ML, Fretz A, Howington M, Sarker M, Huang S, Leiser SF. 2020. Hypoxic response regulators RHY-1 and EGL-9/PHD promote longevity through a VHL-1-independent transcriptional response. GeroScience 42: 1621-1633.
","pubmedId":"","doi":"10.1007/s11357-020-00194-0"},{"reference":"Lee SJ, Hwang AB, Kenyon C. 2010. Inhibition of Respiration Extends C. elegans Life Span via Reactive Oxygen Species that Increase HIF-1 Activity. Current Biology 20: 2131-2136.
","pubmedId":"","doi":"10.1016/j.cub.2010.10.057"},{"reference":"Leiser SF, Kaeberlein M. 2010. The hypoxia-inducible factor HIF-1 functions as both a positive and negative modulator of aging. Biological Chemistry 391: 10.1515/bc.2010.123.
","pubmedId":"","doi":"10.1515/BC.2010.123"},{"reference":"Leiser SF, Miller H, Rossner R, Fletcher M, Leonard A, Primitivo M, et al., Kaeberlein. 2015. Cell nonautonomous activation of flavin-containing monooxygenase promotes longevity and health span. Science 350: 1375-1378.
","pubmedId":"","doi":"10.1126/science.aac9257"},{"reference":"Mehta R, Steinkraus KA, Sutphin GL, Ramos FJ, Shamieh LS, Huh A, et al., Kaeberlein. 2009. Proteasomal Regulation of the Hypoxic Response Modulates Aging in\n C. elegans. Science 324: 1196-1198.
","pubmedId":"","doi":"10.1126/science.1173507"},{"reference":"Rudich ZD, Guan J, Tamez Gonzalez AA, Booth GF, Soo SK, Anglas U, et al., Van Raamsdonk. 2026. Multiple molecular pathways to longevity with opposing gene expression programs defining distinct aging strategies in Caenorhabditis elegans. eLife 15: 10.7554/elife.112139.3.
","pubmedId":"","doi":"10.7554/eLife.112139.3"},{"reference":"Shen C, Nettleton D, Jiang M, Kim SK, Powell-Coffman JA. 2005. Roles of the HIF-1 Hypoxia-inducible Factor during Hypoxia Response in Caenorhabditis elegans. Journal of Biological Chemistry 280: 20580-20588.
","pubmedId":"","doi":"10.1074/jbc.M501894200"},{"reference":"Shen C, Shao Z, Powell-Coffman JA. 2006. The Caenorhabditis elegans rhy-1 Gene Inhibits HIF-1 Hypoxia-Inducible Factor Activity in a Negative Feedback Loop That Does Not Include vhl-1. Genetics 174: 1205-1214.
","pubmedId":"","doi":"10.1534/genetics.106.063594"},{"reference":"Soo SK, Rudich ZD, Ko B, Moldakozhayev A, AlOkda A, Van Raamsdonk JM. 2023. Biological resilience and aging: Activation of stress response pathways contributes to lifespan extension. Ageing Research Reviews 88: 101941.
","pubmedId":"","doi":"10.1016/j.arr.2023.101941"},{"reference":"Van Raamsdonk JM. 2026. Mild mitochondrial impairment activates overlapping longevity pathways converging on the flavin-containing monooxygenase FMO-2. Frontiers in Aging 7: 10.3389/fragi.2026.1808540.
","pubmedId":"","doi":"10.3389/fragi.2026.1808540"},{"reference":"Vora M, Pyonteck SM, Popovitchenko T, Matlack TL, Prashar A, Kane NS, et al., Rongo. 2022. The hypoxia response pathway promotes PEP carboxykinase and gluconeogenesis in C. elegans. Nature Communications 13: 10.1038/s41467-022-33849-x.
","pubmedId":"","doi":"10.1038/s41467-022-33849-x"},{"reference":"Wu Z, Senchuk MM, Dues DJ, Johnson BK, Cooper JF, Lew L, et al., Van Raamsdonk. 2018. Mitochondrial unfolded protein response transcription factor ATFS-1 promotes longevity in a long-lived mitochondrial mutant through activation of stress response pathways. BMC Biology 16: 10.1186/s12915-018-0615-3.
","pubmedId":"","doi":"10.1186/s12915-018-0615-3"},{"reference":"Zhang Y, Shao Z, Zhai Z, Shen C, Powell-Coffman JA. 2009. The HIF-1 Hypoxia-Inducible Factor Modulates Lifespan in C. elegans. PLoS ONE 4: e6348.
","pubmedId":"","doi":"10.1371/journal.pone.0006348"}],"title":"High confidence HIF-1 target genes for quantifying the activation of the HIF-1-mediated hypoxia response
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"e5b6c83b-10ea-4980-b82d-144756b749dc","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}