The C. elegans AKT serine/threonine kinase AKT-1 is widely studied because it is a molecular player in multiple ubiquitous signaling pathways. akt-1 mutants have been associated with gross, organismal-level phenotypes. In addition to organismal physiology, pathways associated with akt-1 are known to regulate neuronal plasticity and behavior; therefore, akt-1 mutants could be valuable for behavioral characterization. Here, we report that akt-1 loss-of-function mutants demonstrate perturbed chemotaxis behaviors which could confound experiments that rely on proper chemosensation. We also determined that adult-only administration of akt-1 RNAi is sufficient to overcome these behavioral deficits, suggesting these defects are likely developmental in origin
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). We thank Dr. Andrea Stavoe for her aid and guidance with akt-1 CRISPR KO design.
","authors":[{"affiliations":["Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health"],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft","writing_reviewEditing"],"email":"Meredith.Williams@bcm.edu","firstName":"Meredith I","lastName":"Williams","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Department of Neuroscience","Department of Pathology and Immunology"],"credit":["investigation","writing_reviewEditing"],"email":"Hope.Msengi@bcm.edu","firstName":"Hope","lastName":"Msengi","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health","Department of Molecular and Cellular Biology"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","writing_reviewEditing","writing_originalDraft"],"email":"rachel.arey@bcm.edu","firstName":"Rachel","lastName":"Arey","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9941-3945"}],"awards":[{"awardId":"DP2NS132372","funderName":"National Institutes of Health (United States)","awardRecipient":"Rachel N Arey"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by NIH Office of the Director (OD; DP2NS132372) to Rachel N Arey.
","image":{"url":"https://portal.micropublication.org/uploads/8932acc6b920d84799d913b75df258c3.jpg"},"imageCaption":"A) 0x outcrossed akt-1(ok525) mutants have abnormally low chemotaxis indices to 10% butanone, due to large percentage of worms distributed around the chemotaxis plate. p-value= <0.0001. n = 15. B) Schematic of akt-1 phenotype observed during the chemotaxis assay. C,D). After 5 rounds (5x) of outcrossing, abnormal chemotaxis behaviors are observed towards strong attractants 0.1% butanone (C) and 1% diacetyl (D) in akt-1(ok525) mutants. p-value= <0.0001. n = 15. E) Schematic of akt-1(ok525) allele and new akt-1(ary2) allele generated by CRISPR. F,G). akt-1(ary2) worms exhibit same abnormal chemotaxis behaviors as akt-1(ok525) animals towards strong attractants 0.1% butanone (F) and 1% diacetyl (G). p-value= <0.0001. n = 15. H) Schematic of timelines of different RNAi administration to knockdown akt-1 in specific tissues and different developmental timepoints. I,J). Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 0.1% butanone in both wild-type (I, p-value = 0.0012) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (J, p-value<0.001) animals. n = 15. K). Wild-type animals receive adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 0.1% butanone. p-value of worms on plate = 0.0490. n = 15. L,M) Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 1% diacetyl in both wild-type (L, p-value < 0.0013, <0.0001) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (M, p-value<0.0001) animals. n = 15. N) Wild-type animals receive adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 1% butanone diacetyl. n = 15.
","imageTitle":"Loss of akt-1 throughout development via mutation or RNAi knockdown causes defective olfactory chemotaxis that can be avoided with adult-only manipulations
","methods":"General C. elegans strains and maintenance
All C. elegans strains were kept at 20°C on either standard nematode growth medium (NGM) plates or NGM plates containing 50ug/mL Carbenicillin and 1.0mM IPTG, referred to as NGICs. Plates were seeded with OP-50 Escherichia coli or HT115 bacteria expressing akt-1 or vector RNAi. Animals were developmentally synchronized using an alkaline-bleach solution on a population of gravid adults for egg collection; eggs were then washed with M9 buffer solution three times before plating on NGMs or NGICs. A list of the strains used and generated in this study are listed in the reagents section below.
Strain development
akt-1(ary2) was generated via CRISPR/Cas9 genome editing and the gRNA and HDR template are listed below. Briefly, a stop codon cassette was inserted at the end of the first exon. The CRISPR/Cas9 injection, screening, and confirmation genotyping were conducted according to previous work. Whole genome sequencing was conducted through the University of Minnesota Model Organism Sequencing Core and confirmed our desired edit and no off-target effects.
gRNA (+ strand):
ACAUUCGAAACUGGAGACCAGUUUUAGAGCUAUGCU
HDR (- strand):
G*T*G GTA ATA TAT GAT CAG TAC CGA TAG AAA AAT CAA ACC TGC TAG CTT ATC ACT TAG TCA CCT CTG CTC TGG ACA AAC ТТС ССС ТАТ СТC CAG TTT CGA ATG TGC ТСТ ССТ ТTC TTG TGA AGC C*A*T
RNAi Treatment
For whole-life RNAi exposure, bleached eggs were immediately plated onto NGICs seeded with H115 bacteria expressing either vector or akt-1 RNAi and tested for behavior on day one of adulthood. For adult-only RNAi exposure, bleached eggs were plated onto NGM plates seeded with OP-50 E. coli. At the L4 stage, worms were washed three times with M9 buffer solution before being transferred to seeded NGICs. Worms were exposed to RNAi for 48 hours before testing on day two of adulthood.
Naïve Chemotaxis Assay
Chemotaxis assays were performed as previously described. Briefly, assays were performed on unseeded 100mm NGM plates with two marks on opposite sides drawn approximately 5mm from the edge. 1uL of sodium azide was placed on both marks and dried before adding 1uL of odorant diluted in ethanol to one mark and 1uL of ethanol to the other. Well-fed, synchronized adult populations were washed into a conical tube using M9 buffer solution and washed three times to remove any residual food. Using a wide-bore pipette tip, worms were then placed near the bottom center of the plate and allowed to chemotax for an hour. Chemotaxis indices were calculated as follows:
Chemotaxis Index= (# of worms on odorant - # of worms on ethanol) / (total # of worms)
We also reported the percent of worms that failed to choose either odorant as calculated below:
Percent Worms on Rest of Plate= (# of wormsrest)/[total # of worms(odorant+ethanol+rest)] x 100
We tested the naïve preference to highly appetitive concentrations of butanone (0.1%) and diacetyl (1%) as previously reported.
Statistics
All statistics were conducted with GraphPad Prism Software. Welch's t-test was used to compare chemotactic indices and percent worms on rest of plate as it does not assume equal standard deviations.
","reagents":"Strain table
Strain | Genotype | Source |
Wild-type Bristol | CGC | |
CGC | ||
CGC | ||
5x RB759 | This study | |
This Study |
The Caenorhabditis elegans AKT-1 serine/threonine kinase ortholog, AKT-1, is an extensively studied gene, with 39 distinct phenotypes reported from 87 independent studies (Blackwell et al., 2019; Sternberg et al., 2024; Alliance of Genome Resources Consortium 2024). Both loss-of-function (LoF) mutants and RNAi-based knockdown have been used to study the multifaceted effects of reduced akt-1 function. These manipulations lead to many altered, gross, organismal-level phenotypes including changes in reproduction, movement, and lifespan (Sternberg et al., 2024). AKT-1 also plays a role in both insulin and mTOR signaling which have well-documented effects on neuronal plasticity and behavior across species (Hoeffer and Klann 2010; Graber et al., 2013; Lee 2015; Borrie et al., 2017). The body of work examining the role of AKT-1 in behavior in the worm is presently much smaller than other organismal phenotypes. Previous studies have found that akt-1 mutants exhibit deficits in salt chemotaxis and an increase in risk-taking behaviors (Tomioka et al., 2006; Jiu et al., 2010). However, an important consideration for behavioral studies is that mutants should not exhibit phenotypes that could confound interpretation of changes in behavioral outputs. For chemosensation-based assays, such as those that measure olfactory adaptation and learning and memory, perturbations in a worm's ability to detect an odor may be perceived as a learning or memory deficit rather than impaired olfaction (Colbert and Bargmann 1995; Stetak et al., 2009; Kauffman et al., 2010). This is an important distinction because unreported phenotypes, like chemosensory abnormalities, could lead to false positive results in future studies. Here we report that the commonly used akt-1(ok525) mutant demonstrates previously unreported perturbed chemotaxis behaviors that persist even in a new CRISPR LoF line, which limits the usefulness of akt-1 mutants for many behavioral studies.
Mutation of akt-1 leads to defective chemotaxis
To examine the chemotactic ability of akt-1(ok525) mutants, we used well-established, population-based assays where worms are exposed to an odorant that they have never encountered on an agar plate (Bargmann et al., 1993). While conducting preliminary chemotaxis (CTX) assays using a neutral concentration of butanone (10%), we observed that akt-1(ok525) animals that had not been outcrossed (0x) displayed a deficit compared to control (1A-left). We found that this deficit was due to animals not choosing either odor, represented by a high percentage of animals left on the plate (1A-right), and instead crawling towards the sides and walls of the plate (1B). To determine if the deficit was the result of background mutations or due to the presence of the akt-1 mutation, we outcrossed akt-1(ok525) animals with wild-type worms five times [5x akt-1(ok525)]. We then tested their chemotaxis towards two attractive odors - an attractive concentration of butanone (0.1%, 1C) and diacetyl (1%,1D) to examine this phenotype more robustly. We chose these odorants because they require different sensory neurons, with attractive butanone chemosensation requiring the AWC neuron while attractive diacetyl chemosensation requires the AWA neuron (Bargmann et al., 1993; Wes and Bargmann 2001). We observed deficits in the naïve CTX of the 5x akt-1(ok525) line to both odorants and concomitant increases in percent animals left on the plate, suggesting a broad effect involving many neurons and potentially multiple tissues. Since the deletion in the akt-1(ok525) line is very large (1E), we decided to create a more targeted LoF mutant using CRISPR/Cas9 (Evans 2006; Katic and Großhans 2013; Paix et al., 2015; Dickinson and Goldstein 2016; Schwartz et al., 2021). Briefly, we inserted a stop cassette at the end of the first exon in akt-1(ary2) (1E) and confirmed this edit via whole-genome sequencing (Dickinson and Goldstein 2016; Calarco et al., 2025). We then tested the akt-1(ary2) strain's naïve CTX towards the same strong attractants and again observed a deficit to both odorants and an increase in the number of animals left on the plate (1F-G), similar to the akt-1(ok525) strain. This suggests that genetic loss of akt-1, irrespective of the mutation introduced, is sufficient to drive this abnormal chemotactic behavior.
RNAi knockdown of akt-1 reveals a likely developmental origin of chemotaxis deficits that can be prevented with adult-only RNAi administration
We next sought to establish if knockdown of akt-1 via RNAi could circumvent the abnormal chemotaxis phenotype through more temporal and spatial control of gene manipulation (Zhuang and Hunter 2012). We administered akt-1 RNAi to wild-type animals, which excludes knockdown in neurons, and a neuron-specific RNAi line (sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1], Yang et al., 2024). This RNAi treatment was performed either for the whole-life (WL, from hatch) or in adulthood (adult-only, AO). These conditions would allow us to determine if timing or neuron-specific loss was sufficient to overcome the phenotypes we had observed in mutant strains (1H) (Zhuang and Hunter 2012; Yang et al., 2024). We first fed wild-type worms akt-1 RNAi for their entire life, which would most closely mimic the mutant condition (excluding neurons) to see if the abnormal chemotaxis behaviors would persist. We found that RNAi against akt-1 administered WL in a wild-type background recapitulated our LoF mutants and observed CTX deficits to both butanone (1I) and diacetyl (1L). Since RNAi administration in a wild-type background excludes neurons and produced CTX deficits, we hypothesized that knockdown in only neuronal tissues might not have an effect on CTX behaviors. Utilizing a genetic, neuron-specific strain, we administered WL RNAi against akt-1 and found that knockdown in neurons alone was sufficient to recapitulate the chemotactic deficits and subsequent increase in the percent of worms left on the plate (1J, 1M). This suggests that akt-1 plays an important developmental role in multiple tissues in influencing sensory neuron function and that loss of akt-1 in this critical window manifests in altered adult behaviors. AO administration in previous studies has proven to be a successful way to interrogate a gene's effect on behavior apart from its role in regulating development (Kaletsky et al., 2016; Arey et al., 2019; Hayden et al., 2024; Qin et al., 2025). Interestingly, we found that AO administration of akt-1 in a wild-type background had no detectable effect on chemotaxis to both attractive odorants and resulted in low amounts of worms left on the plate (1K, 1N). These results indicate that the abnormal chemotaxis behaviors described are likely a result of akt-1 influence on development as systemic AO knockdown did not produce similar behaviors.
Limitations and future directions
We have shown that loss of akt-1 throughout development, through either genetic manipulation or RNAi, is sufficient to produce abnormal olfactory chemotaxis behaviors. We also found that AO RNAi administration is sufficient to uncouple the developmental effects of akt-1 from its influence on chemotactic assays. Therefore, future studies investigating akt-1 in phenotypes that include an olfactory sensory component outside the context of development should be sure to use carefully timed knockdown approaches. For this study, we did not employ the auxin-inducible degron (AID) system which is another method offering temporal specificity in knockdowns (Zhang et al, 2015; Ashley et al., 2021). We expect that an akt-1 AID system will behave similarly to the AO RNAi administration line as long as the knockdown is induced after the completion of neuronal development.
","references":[{"reference":"Alliance of Genome Resources Consortium. 2024. Updates to the Alliance of Genome Resources central infrastructure. Genetics 227(1): 10.1093/genetics/iyae049.
","pubmedId":"38552170","doi":""},{"reference":"Arey RN, Kaletsky R, Murphy CT. 2019. Nervous system-wide profiling of presynaptic mRNAs reveals regulators of associative memory. Sci Rep 9(1): 20314.
","pubmedId":"31889133","doi":""},{"reference":"Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, et al., Ward JD. 2021. An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Genetics 217(3): 10.1093/genetics/iyab006.
","pubmedId":"33677541","doi":""},{"reference":"Bargmann CI, Hartwieg E, Horvitz HR. 1993. Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74(3): 515-27.
","pubmedId":"8348618","doi":""},{"reference":"Blackwell TK, Sewell AK, Wu Z, Han M. 2019. TOR Signaling in Caenorhabditis elegans Development, Metabolism, and Aging. Genetics 213(2): 329-360.
","pubmedId":"31594908","doi":""},{"reference":"Borrie SC, Brems H, Legius E, Bagni C. 2017. Cognitive Dysfunctions in Intellectual Disabilities: The Contributions of the Ras-MAPK and PI3K-AKT-mTOR Pathways. Annu Rev Genomics Hum Genet 18: 115-142.
","pubmedId":"28859574","doi":""},{"reference":"Calarco JA, Taylor SR, Miller DM 3rd. 2025. Detecting gene expression in Caenorhabditis elegans. Genetics 229(1): 1-108.
","pubmedId":"39693264","doi":""},{"reference":"Colbert HA, Bargmann CI. 1995. Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14(4): 803-12.
","pubmedId":"7718242","doi":""},{"reference":"Dickinson DJ, Goldstein B. 2016. CRISPR-Based Methods for Caenorhabditis elegans Genome Engineering. Genetics 202(3): 885-901.
","pubmedId":"26953268","doi":""},{"reference":"Evans T. 2006. Transformation and microinjection. WormBook : 10.1895/wormbook.1.108.1.
","pubmedId":"","doi":"10.1895/wormbook.1.108.1"},{"reference":"Graber TE, McCamphill PK, Sossin WS. 2013. A recollection of mTOR signaling in learning and memory. Learn Mem 20(10): 518-30.
","pubmedId":"24042848","doi":""},{"reference":"Hayden AN, Brandel KL, Pietryk EW, Merlau PR, Vijayakumar P, Leptich EJ, et al., Arey RN. 2024. Behavioral screening reveals a conserved residue in Y-Box RNA-binding protein required for associative learning and memory in C. elegans. PLoS Genet 20(10): e1011443.
","pubmedId":"39423228","doi":""},{"reference":"Hoeffer CA, Klann E. 2010. mTOR signaling: at the crossroads of plasticity, memory and disease. Trends Neurosci 33(2): 67-75.
","pubmedId":"19963289","doi":""},{"reference":"Jiu YM, Yue Y, Yang S, Liu L, Yu JW, Wu ZX, Xu T. 2010. Insulin-like signaling pathway functions in integrative response to an olfactory and a gustatory stimuli in Caenorhabditis elegans. Protein Cell 1(1): 75-81.
","pubmedId":"21203999","doi":""},{"reference":"Katic I, Großhans H. 2013. Targeted heritable mutation and gene conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics 195(3): 1173-6.
","pubmedId":"23979578","doi":""},{"reference":"Kaletsky R, Lakhina V, Arey R, Williams A, Landis J, Ashraf J, Murphy CT. 2016. The C. elegans adult neuronal IIS/FOXO transcriptome reveals adult phenotype regulators. Nature 529(7584): 92-6.
","pubmedId":"26675724","doi":""},{"reference":"Kauffman AL, Ashraf JM, Corces-Zimmerman MR, Landis JN, Murphy CT. 2010. Insulin signaling and dietary restriction differentially influence the decline of learning and memory with age. PLoS Biol 8(5): e1000372.
","pubmedId":"20502519","doi":""},{"reference":"Lee DY. 2015. Roles of mTOR Signaling in Brain Development. Exp Neurobiol 24(3): 177-85.
","pubmedId":"26412966","doi":""},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics 201(1): 47-54.
","pubmedId":"26187122","doi":""},{"reference":"Qin C, Liu Z, Duan D, Wu L. 2025. Genome-wide RNAi analysis in adult Caenorhabditis elegans unveils genes controlling age-related fat accumulation. Mech Ageing Dev 226: 112089.
","pubmedId":"40617488","doi":""},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet 17(11): e1009755.
","pubmedId":"34748534","doi":""},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics 227(1): 10.1093/genetics/iyae050.
","pubmedId":"38573366","doi":""},{"reference":"Stetak A, Hörndli F, Maricq AV, van den Heuvel S, Hajnal A. 2009. Neuron-specific regulation of associative learning and memory by MAGI-1 in C. elegans. PLoS One 4(6): e6019.
","pubmedId":"19551147","doi":""},{"reference":"Tomioka M, Adachi T, Suzuki H, Kunitomo H, Schafer WR, Iino Y. 2006. The insulin/PI 3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans. Neuron 51(5): 613-25.
","pubmedId":"16950159","doi":""},{"reference":"Wes PD, Bargmann CI. 2001. C. elegans odour discrimination requires asymmetric diversity in olfactory neurons. Nature 410(6829): 698-701.
","pubmedId":"11287957","doi":""},{"reference":"Yang Y, Arnold ML, Lange CM, Sun LH, Broussalian M, Doroodian S, et al., Hansen M. 2024. Autophagy protein ATG-16.2 and its WD40 domain mediate the beneficial effects of inhibiting early-acting autophagy genes in C. elegans neurons. Nat Aging 4(2): 198-212.
","pubmedId":"38177330","doi":""},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142(24): 4374-84.
","pubmedId":"26552885","doi":""},{"reference":"Zhuang JJ, Hunter CP. 2012. RNA interference in Caenorhabditis elegans: uptake, mechanism, and regulation. Parasitology 139(5): 560-73.
","pubmedId":"22075748","doi":""}],"title":"Loss of akt-1 throughout development leads to abnormal chemosensory behaviors in C. elegans
","reviews":[{"reviewer":{"displayName":"Anne Hart"},"openAcknowledgement":false,"status":{"submitted":true}}],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]},{"id":"6e25ad5c-0246-4326-8086-59b355caec80","decision":"revise","abstract":"The C. elegans AKT serine/threonine kinase AKT-1 is widely studied because it is a molecular player in multiple ubiquitous signaling pathways. akt-1 mutants have been associated with gross, organismal-level phenotypes. In addition to organismal physiology, pathways associated with akt-1 are known to regulate neuronal plasticity and behavior; therefore, akt-1 mutants could be valuable for behavioral characterization. Here, we report that akt-1 loss-of-function mutants demonstrate perturbed chemotaxis behaviors which could confound experiments that rely on proper chemosensation. We also determined that adult-only administration of akt-1 RNAi is sufficient to overcome these behavioral deficits, suggesting these defects are likely developmental in origin
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). We thank Dr. Andrea Stavoe for her aid and guidance with akt-1 CRISPR KO design.
","authors":[{"affiliations":["Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health"],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft","writing_reviewEditing"],"email":"Meredith.Williams@bcm.edu","firstName":"Meredith I","lastName":"Williams","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Department of Neuroscience","Department of Pathology and Immunology"],"credit":["investigation","writing_reviewEditing"],"email":"Hope.Msengi@bcm.edu","firstName":"Hope","lastName":"Msengi","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health","Department of Molecular and Cellular Biology"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","writing_reviewEditing","writing_originalDraft"],"email":"rachel.arey@bcm.edu","firstName":"Rachel","lastName":"Arey","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9941-3945"}],"awards":[{"awardId":"DP2NS132372","funderName":"National Institutes of Health (United States)","awardRecipient":"Rachel N Arey"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by NIH Office of the Director (OD; DP2NS132372) to Rachel N Arey.
","image":{"url":"https://portal.micropublication.org/uploads/4c936080ce8df57374bb5c5a9facd2c1.jpg"},"imageCaption":"A) 0x outcrossed akt-1(ok525) mutants have abnormally low chemotaxis indices to 10% butanone, due to large percentage of worms distributed around the chemotaxis plate. p-value= <0.0001. n = 15 assay plates. B) Schematic of akt-1 phenotype observed during the chemotaxis assay. C,D). After 5 rounds (5x) of outcrossing, abnormal chemotaxis behaviors are observed towards strong attractants 0.1% butanone (C) and 1% diacetyl (D) in akt-1(ok525) mutants. p-value= <0.0001. n = 15 assay plates. E) Schematic of akt-1(ok525) allele and new akt-1(ary2) allele generated by CRISPR. F,G). akt-1(ary2) worms exhibit same abnormal chemotaxis behaviors as akt-1(ok525) animals towards strong attractants 0.1% butanone (F) and 1% diacetyl (G). p-value= <0.0001. n = 15 assay plates. H) Schematic of timelines of different RNAi administration to knockdown akt-1 in specific tissues and different developmental timepoints. I,J). Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 0.1% butanone in both wild-type (I, p-value = 0.0012) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (J, p-value<0.001) animals. n = 15 assay plates. K). Wild-type animals receive adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 0.1% butanone. p-value of worms on plate = 0.0490. n = 15 assay plates. L,M) Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 1% diacetyl in both wild-type (L, p-value < 0.0013, <0.0001) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (M, p-value<0.0001) animals. n = 15 assay plates. N) Wild-type animals receive adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 1% butanone diacetyl. n = 15 assay plates.
","imageTitle":"Loss of akt-1 throughout development via mutation or RNAi knockdown causes defective olfactory chemotaxis that can be avoided with adult-only manipulations
","methods":"General C. elegans strains and maintenance
All C. elegans strains were kept at 20°C on either standard nematode growth medium (NGM) plates or NGM plates containing 50ug/mL Carbenicillin and 1.0mM IPTG, referred to as NGICs. Plates were seeded with OP-50 Escherichia coli or HT115 bacteria expressing akt-1 or vector RNAi. Animals were developmentally synchronized using an alkaline-bleach solution on a population of gravid adults for egg collection; eggs were then washed with M9 buffer solution three times before plating on NGMs or NGICs. A list of the strains used and generated in this study are listed in the reagents section below.
Strain development
akt-1(ary2) was generated via CRISPR/Cas9 genome editing and the gRNA and HDR template are listed below. Briefly, a stop codon cassette was inserted at the end of the first exon. The CRISPR/Cas9 injection, screening, and confirmation genotyping were conducted according to previous work. Whole genome sequencing was conducted through the University of Minnesota Model Organism Sequencing Core and confirmed our desired edit and no off-target effects.
gRNA (+ strand):
ACAUUCGAAACUGGAGACCAGUUUUAGAGCUAUGCU
HDR (- strand):
G*T*G GTA ATA TAT GAT CAG TAC CGA TAG AAA AAT CAA ACC TGC TAG CTT ATC ACT TAG TCA CCT CTG CTC TGG ACA AAC ТТС ССС ТАТ СТC CAG TTT CGA ATG TGC ТСТ ССТ ТTC TTG TGA AGC C*A*T
RNAi Treatment
For whole-life RNAi exposure, bleached eggs were immediately plated onto NGICs seeded with H115 bacteria expressing either vector or akt-1 RNAi and tested for behavior on day one of adulthood. For adult-only RNAi exposure, bleached eggs were plated onto NGM plates seeded with OP-50 E. coli. At the L4 stage, worms were washed three times with M9 buffer solution before being transferred to seeded NGICs. Worms were exposed to RNAi for 48 hours before testing on day two of adulthood.
Naïve Chemotaxis Assay
Chemotaxis assays were performed as previously described. Briefly, assays were performed on unseeded 100mm NGM plates with two circles on opposite sides drawn approximately 5mm from the edge (See 1B for illustration). 1uL of sodium azide was placed in the middle of both circles and dried before adding 1uL of odorant diluted in ethanol to the top left circle and 1uL of ethanol to the top right circle (1B). Well-fed, synchronized adult populations were washed into a conical tube using M9 buffer solution and washed three times to remove any residual food. Using a wide-bore pipette tip, worms were then placed near the bottom center circle (1B), or origin, of the plate and allowed to chemotax for an hour. Chemotaxis indices were calculated per plate as follows:
Chemotaxis Index= (# of worms on odorant - # of worms on ethanol) / (total # of worms)
We also reported the percent of worms that failed to choose either odorant as calculated per plate below:
Percent Worms on Rest of Plate= (# of wormsrest of plate)/[total # of worms(odorant+ethanol+rest of plate)] x 100
We define “rest of plate” as worms outside the odorant circles and origin (See 1B for illustration). We tested the naïve preference to highly appetitive concentrations of butanone (0.1%) and diacetyl (1%) as previously reported. Each chemotaxis plate is represented as its own datapoint, with figures comprising five technical replicates per three independent populations for a total of 15 datapoints.
Statistics
All statistics were conducted with GraphPad Prism Software version 11.0.0. Welch's t-test was used to compare chemotactic indices and percent worms on rest of plate as it does not assume equal standard deviations.
","reagents":"Strain table
Strain | Genotype | Source |
Wild-type Bristol | CGC | |
CGC | ||
CGC | ||
5x RB759 | This study | |
This Study |
The Caenorhabditis elegans AKT-1 serine/threonine kinase ortholog, AKT-1, is an extensively studied gene, with 39 distinct phenotypes reported from 87 independent studies (Blackwell et al., 2019; Sternberg et al., 2024; Alliance of Genome Resources Consortium 2024). Both loss-of-function (LoF) mutants and RNAi-based knockdown have been used to study the multifaceted effects of reduced akt-1 function. These manipulations lead to many altered, gross, organismal-level phenotypes including changes in reproduction, movement, and lifespan (Sternberg et al., 2024). AKT-1 also plays a role in both insulin and mTOR signaling which have well-documented effects on neuronal plasticity and behavior across species (Hoeffer and Klann 2010; Graber et al., 2013; Lee 2015; Borrie et al., 2017). The body of work examining the role of AKT-1 in behavior in the worm is presently much smaller than other organismal phenotypes. Previous studies have found that akt-1 mutants exhibit deficits in salt chemotaxis and an increase in risk-taking behaviors (Tomioka et al., 2006; Jiu et al., 2010). However, an important consideration for behavioral studies is that mutants should not exhibit phenotypes that could confound interpretation of changes in behavioral outputs. For chemosensation-based assays, such as those that measure olfactory adaptation and learning and memory, perturbations in a worm's ability to detect an odor may be perceived as a learning or memory deficit rather than impaired olfaction (Colbert and Bargmann 1995; Stetak et al., 2009; Kauffman et al., 2010). This is an important distinction because unreported phenotypes, like chemosensory abnormalities, could lead to false positive results in future studies. Here we report that the commonly used akt-1(ok525) mutant demonstrates previously unreported perturbed chemotaxis behaviors that persist even in a new CRISPR LoF line, which limits the usefulness of akt-1 mutants for many behavioral studies.
Mutation of akt-1 leads to defective chemotaxis
To examine the chemotactic ability of akt-1(ok525) mutants, we used well-established, population-based assays where worms are exposed to an odorant that they have never encountered on an agar plate (Bargmann et al., 1993). While conducting preliminary chemotaxis (CTX) assays using a neutral concentration of butanone (10%), we observed that akt-1(ok525) animals that had not been outcrossed (0x) displayed a deficit compared to control (1A-left). We found that this deficit was due to animals not choosing either odor, represented by a high percentage of animals left on the plate (1A-right), and instead crawling towards the sides and walls of the plate (1B). To determine if the deficit was the result of background mutations or due to the presence of the akt-1 mutation, we outcrossed akt-1(ok525) animals with wild-type worms five times [5x akt-1(ok525)]. We then tested their chemotaxis towards two attractive odors - an attractive concentration of butanone (0.1%, 1C) and diacetyl (1%,1D) to examine this phenotype more robustly. We chose these odorants because they require different sensory neurons, with attractive butanone chemosensation requiring the AWC neuron while attractive diacetyl chemosensation requires the AWA neuron (Bargmann et al., 1993; Wes and Bargmann 2001). We observed deficits in the naïve CTX of the 5x akt-1(ok525) line to both odorants and concomitant increases in percent animals left on the plate, suggesting a broad effect involving many neurons and potentially multiple tissues. Since the deletion in the akt-1(ok525) line is very large (1E), we decided to create a more targeted LoF mutant using CRISPR/Cas9 (Evans 2006; Katic and Großhans 2013; Paix et al., 2015; Dickinson and Goldstein 2016; Schwartz et al., 2021). Briefly, we inserted a stop cassette at the end of the first exon in akt-1(ary2) (1E) and confirmed this edit via whole-genome sequencing (Dickinson and Goldstein 2016; Calarco et al., 2025). We then tested the akt-1(ary2) strain's naïve CTX towards the same strong attractants and again observed a deficit to both odorants and an increase in the number of animals left on the plate (1F-G), similar to the akt-1(ok525) strain. This suggests that genetic loss of akt-1, irrespective of the mutation introduced, is sufficient to drive this abnormal chemotactic behavior.
RNAi knockdown of akt-1 reveals a likely developmental origin of chemotaxis deficits that can be prevented with adult-only RNAi administration
We next sought to establish if knockdown of akt-1 via RNAi could circumvent the abnormal chemotaxis phenotype through more temporal and spatial control of gene manipulation (Zhuang and Hunter 2012). We administered akt-1 RNAi to wild-type animals, which excludes knockdown in neurons, and a neuron-specific RNAi line (sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1], Yang et al., 2024). This RNAi treatment was performed either for the whole-life (WL, from hatch) or in adulthood (adult-only, AO). These conditions would allow us to determine if timing or neuron-specific loss was sufficient to overcome the phenotypes we had observed in mutant strains (1H) (Zhuang and Hunter 2012; Yang et al., 2024). We first fed wild-type worms akt-1 RNAi for their entire life, which would most closely mimic the mutant condition (excluding neurons) to see if the abnormal chemotaxis behaviors would persist. We found that RNAi against akt-1 administered WL in a wild-type background recapitulated our LoF mutants and observed CTX deficits to both butanone (1I) and diacetyl (1L). Since RNAi administration in a wild-type background excludes neurons and produced CTX deficits, we hypothesized that knockdown in only neuronal tissues might not have an effect on CTX behaviors. Utilizing a genetic, neuron-specific strain, we administered WL RNAi against akt-1 and found that knockdown in neurons alone was sufficient to recapitulate the chemotactic deficits and subsequent increase in the percent of worms left on the plate (1J, 1M). This suggests that akt-1 plays an important developmental role in multiple tissues in influencing sensory neuron function and that loss of akt-1 in this critical window manifests in altered adult behaviors. AO administration in previous studies has proven to be a successful way to interrogate a gene's effect on behavior apart from its role in regulating development (Kaletsky et al., 2016; Arey et al., 2019; Hayden et al., 2024; Qin et al., 2025). Interestingly, we found that AO administration of akt-1 in a wild-type background had no detectable effect on chemotaxis to both attractive odorants and resulted in low amounts of worms left on the plate (1K, 1N). These results indicate that the abnormal chemotaxis behaviors described are likely a result of akt-1 influence on development as systemic AO knockdown did not produce similar behaviors.
Limitations and future directions
We have shown that loss of akt-1 throughout development, through either genetic manipulation or RNAi, is sufficient to produce abnormal olfactory chemotaxis behaviors. We also found that AO RNAi administration is sufficient to uncouple the developmental effects of akt-1 from its influence on chemotactic assays. Therefore, future studies investigating akt-1 in phenotypes that include an olfactory sensory component outside the context of development should be sure to use carefully timed knockdown approaches. For this study, we did not employ the auxin-inducible degron (AID) system which is another method offering temporal specificity in knockdowns (Zhang et al, 2015; Ashley et al., 2021). We expect that an akt-1 AID system will behave similarly to the AO RNAi administration line as long as the knockdown is induced after the completion of neuronal development.
","references":[{"reference":"Alliance of Genome Resources Consortium. 2024. Updates to the Alliance of Genome Resources central infrastructure. Genetics 227(1): 10.1093/genetics/iyae049.
","pubmedId":"38552170","doi":""},{"reference":"Arey RN, Kaletsky R, Murphy CT. 2019. Nervous system-wide profiling of presynaptic mRNAs reveals regulators of associative memory. Sci Rep 9(1): 20314.
","pubmedId":"31889133","doi":""},{"reference":"Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, et al., Ward JD. 2021. An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Genetics 217(3): 10.1093/genetics/iyab006.
","pubmedId":"33677541","doi":""},{"reference":"Bargmann CI, Hartwieg E, Horvitz HR. 1993. Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74(3): 515-27.
","pubmedId":"8348618","doi":""},{"reference":"Blackwell TK, Sewell AK, Wu Z, Han M. 2019. TOR Signaling in Caenorhabditis elegans Development, Metabolism, and Aging. Genetics 213(2): 329-360.
","pubmedId":"31594908","doi":""},{"reference":"Borrie SC, Brems H, Legius E, Bagni C. 2017. Cognitive Dysfunctions in Intellectual Disabilities: The Contributions of the Ras-MAPK and PI3K-AKT-mTOR Pathways. Annu Rev Genomics Hum Genet 18: 115-142.
","pubmedId":"28859574","doi":""},{"reference":"Calarco JA, Taylor SR, Miller DM 3rd. 2025. Detecting gene expression in Caenorhabditis elegans. Genetics 229(1): 1-108.
","pubmedId":"39693264","doi":""},{"reference":"Colbert HA, Bargmann CI. 1995. Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14(4): 803-12.
","pubmedId":"7718242","doi":""},{"reference":"Dickinson DJ, Goldstein B. 2016. CRISPR-Based Methods for Caenorhabditis elegans Genome Engineering. Genetics 202(3): 885-901.
","pubmedId":"26953268","doi":""},{"reference":"Evans T. 2006. Transformation and microinjection. WormBook : 10.1895/wormbook.1.108.1.
","pubmedId":"","doi":"10.1895/wormbook.1.108.1"},{"reference":"Graber TE, McCamphill PK, Sossin WS. 2013. A recollection of mTOR signaling in learning and memory. Learn Mem 20(10): 518-30.
","pubmedId":"24042848","doi":""},{"reference":"Hayden AN, Brandel KL, Pietryk EW, Merlau PR, Vijayakumar P, Leptich EJ, et al., Arey RN. 2024. Behavioral screening reveals a conserved residue in Y-Box RNA-binding protein required for associative learning and memory in C. elegans. PLoS Genet 20(10): e1011443.
","pubmedId":"39423228","doi":""},{"reference":"Hoeffer CA, Klann E. 2010. mTOR signaling: at the crossroads of plasticity, memory and disease. Trends Neurosci 33(2): 67-75.
","pubmedId":"19963289","doi":""},{"reference":"Jiu YM, Yue Y, Yang S, Liu L, Yu JW, Wu ZX, Xu T. 2010. Insulin-like signaling pathway functions in integrative response to an olfactory and a gustatory stimuli in Caenorhabditis elegans. Protein Cell 1(1): 75-81.
","pubmedId":"21203999","doi":""},{"reference":"Katic I, Großhans H. 2013. Targeted heritable mutation and gene conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics 195(3): 1173-6.
","pubmedId":"23979578","doi":""},{"reference":"Kaletsky R, Lakhina V, Arey R, Williams A, Landis J, Ashraf J, Murphy CT. 2016. The C. elegans adult neuronal IIS/FOXO transcriptome reveals adult phenotype regulators. Nature 529(7584): 92-6.
","pubmedId":"26675724","doi":""},{"reference":"Kauffman AL, Ashraf JM, Corces-Zimmerman MR, Landis JN, Murphy CT. 2010. Insulin signaling and dietary restriction differentially influence the decline of learning and memory with age. PLoS Biol 8(5): e1000372.
","pubmedId":"20502519","doi":""},{"reference":"Lee DY. 2015. Roles of mTOR Signaling in Brain Development. Exp Neurobiol 24(3): 177-85.
","pubmedId":"26412966","doi":""},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics 201(1): 47-54.
","pubmedId":"26187122","doi":""},{"reference":"Qin C, Liu Z, Duan D, Wu L. 2025. Genome-wide RNAi analysis in adult Caenorhabditis elegans unveils genes controlling age-related fat accumulation. Mech Ageing Dev 226: 112089.
","pubmedId":"40617488","doi":""},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet 17(11): e1009755.
","pubmedId":"34748534","doi":""},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics 227(1): 10.1093/genetics/iyae050.
","pubmedId":"38573366","doi":""},{"reference":"Stetak A, Hörndli F, Maricq AV, van den Heuvel S, Hajnal A. 2009. Neuron-specific regulation of associative learning and memory by MAGI-1 in C. elegans. PLoS One 4(6): e6019.
","pubmedId":"19551147","doi":""},{"reference":"Tomioka M, Adachi T, Suzuki H, Kunitomo H, Schafer WR, Iino Y. 2006. The insulin/PI 3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans. Neuron 51(5): 613-25.
","pubmedId":"16950159","doi":""},{"reference":"Wes PD, Bargmann CI. 2001. C. elegans odour discrimination requires asymmetric diversity in olfactory neurons. Nature 410(6829): 698-701.
","pubmedId":"11287957","doi":""},{"reference":"Yang Y, Arnold ML, Lange CM, Sun LH, Broussalian M, Doroodian S, et al., Hansen M. 2024. Autophagy protein ATG-16.2 and its WD40 domain mediate the beneficial effects of inhibiting early-acting autophagy genes in C. elegans neurons. Nat Aging 4(2): 198-212.
","pubmedId":"38177330","doi":""},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142(24): 4374-84.
","pubmedId":"26552885","doi":""},{"reference":"Zhuang JJ, Hunter CP. 2012. RNA interference in Caenorhabditis elegans: uptake, mechanism, and regulation. Parasitology 139(5): 560-73.
","pubmedId":"22075748","doi":""}],"title":"Loss of akt-1 throughout development leads to abnormal chemosensory behaviors in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":"1792250526805"},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1793066495606"}]},{"id":"27fc2407-d7b6-4838-a736-b61dd1b92f89","decision":"accept","abstract":"The C. elegans AKT serine/threonine kinase AKT-1 is widely studied because it is a molecular player in multiple ubiquitous signaling pathways. akt-1 mutants have been associated with gross, organismal-level phenotypes. In addition to organismal physiology, pathways associated with akt-1 are known to regulate neuronal plasticity and behavior; therefore, akt-1 mutants could be valuable for behavioral characterization. Here, we report that akt-1 loss-of-function mutants demonstrate perturbed chemotaxis behaviors which could confound experiments that rely on proper chemosensation. We also determined that adult-only administration of akt-1 RNAi is sufficient to overcome these behavioral deficits, suggesting these defects are likely developmental in origin
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). We thank Dr. Andrea Stavoe for her aid and guidance with akt-1 CRISPR KO design.
","authors":[{"affiliations":["Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health"],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft","writing_reviewEditing"],"email":"Meredith.Williams@bcm.edu","firstName":"Meredith I","lastName":"Williams","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Department of Neuroscience","Department of Pathology and Immunology"],"credit":["investigation","writing_reviewEditing"],"email":"Hope.Msengi@bcm.edu","firstName":"Hope","lastName":"Msengi","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health","Department of Molecular and Cellular Biology"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","writing_reviewEditing","writing_originalDraft"],"email":"rachel.arey@bcm.edu","firstName":"Rachel","lastName":"Arey","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9941-3945"}],"awards":[{"awardId":"DP2NS132372","funderName":"National Institutes of Health (United States)","awardRecipient":"Rachel N Arey"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by NIH Office of the Director (OD; DP2NS132372) to Rachel N Arey.
","image":{"url":"https://portal.micropublication.org/uploads/5b5bd7263b9ed2c1726b435db9b44985.jpg"},"imageCaption":"A) 0x outcrossed akt-1(ok525) mutants have abnormally low chemotaxis indices to 10% butanone, due to large percentage of worms distributed around the chemotaxis plate. p-value= <0.0001. n = 15 assay plates. B) Schematic of akt-1 phenotype observed during the chemotaxis assay. C,D). After 5 rounds (5x) of outcrossing, abnormal chemotaxis behaviors are observed towards strong attractants 0.1% butanone (C) and 1% diacetyl (D) in akt-1(ok525) mutants. p-value= <0.0001. n = 15 assay plates. E) Schematic of akt-1(ok525) allele and new akt-1(ary2) allele generated by CRISPR. F,G). akt-1(ary2) worms exhibit same abnormal chemotaxis behaviors as akt-1(ok525) animals towards strong attractants 0.1% butanone (F) and 1% diacetyl (G). p-value= <0.0001. n = 15 assay plates. H) Schematic of timelines of different RNAi administration to knockdown akt-1 in specific tissues and different developmental timepoints. I,J). Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 0.1% butanone in both wild-type (I, p-value = 0.0012) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (J, p-value<0.001) animals. n = 15 assay plates. K). Wild-type animals receive adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 0.1% butanone. p-value of worms on plate = 0.0490. n = 15 assay plates. L,M) Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 1% diacetyl in both wild-type (L, p-value < 0.0013, <0.0001) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (M, p-value<0.0001) animals. n = 15 assay plates. N) Wild-type animals receive adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 1% butanone diacetyl. n = 15 assay plates.
","imageTitle":"Loss of akt-1 throughout development via mutation or RNAi knockdown causes defective olfactory chemotaxis that can be avoided with adult-only manipulations
","methods":"General C. elegans strains and maintenance
All C. elegans strains were kept at 20°C on either standard nematode growth medium (NGM) plates or NGM plates containing 50ug/mL Carbenicillin and 1.0mM IPTG, referred to as NGICs. Plates were seeded with OP50 Escherichia coli or HT115 bacteria expressing akt-1 RNAi (Clone purchased from Horizon; Catalog #RCE1182-202292360) or vector RNAi. Animals were developmentally synchronized using an alkaline-bleach solution on a population of gravid adults for egg collection; eggs were then washed with M9 buffer solution three times before plating on NGMs or NGICs. A list of the strains used and generated in this study are listed in the reagents section below.
Strain development
akt-1(ary2) was generated via CRISPR/Cas9 genome editing and the gRNA and HDR template are listed below. Briefly, a stop codon cassette was inserted at the end of the first exon. The CRISPR/Cas9 injection, screening, and confirmation genotyping were conducted according to previous work. Whole genome sequencing was conducted through the University of Minnesota Model Organism Sequencing Core and confirmed our desired edit and no off-target effects.
gRNA (+ strand):
ACAUUCGAAACUGGAGACCAGUUUUAGAGCUAUGCU
HDR (- strand):
G*T*G GTA ATA TAT GAT CAG TAC CGA TAG AAA AAT CAA ACC TGC TAG CTT ATC ACT TAG TCA CCT CTG CTC TGG ACA AAC ТТС ССС ТАТ СТC CAG TTT CGA ATG TGC ТСТ ССТ ТTC TTG TGA AGC C*A*T
RNAi Treatment
For whole-life RNAi exposure, bleached eggs were immediately plated onto NGICs seeded with H115 bacteria expressing either vector or akt-1 RNAi (Horizon and tested for behavior on day one of adulthood. For adult-only RNAi exposure, bleached eggs were plated onto NGM plates seeded with OP50 E. coli. At the L4 stage, worms were washed three times with M9 buffer solution before being transferred to seeded NGICs. Worms were exposed to RNAi for 48 hours before testing on day two of adulthood.
Naïve Chemotaxis Assay
Chemotaxis assays were performed as previously described. Briefly, assays were performed on unseeded 100mm NGM plates with two circles on opposite sides drawn approximately 5mm from the edge (See 1B for illustration). 1uL of sodium azide was placed in the middle of both circles and dried before adding 1uL of odorant diluted in ethanol to the top left circle and 1uL of ethanol to the top right circle (1B). Well-fed, synchronized adult populations were washed into a conical tube using M9 buffer solution and washed three times to remove any residual food. Using a wide-bore pipette tip, worms were then placed near the bottom center circle (1B), or origin, of the plate and allowed to chemotax for an hour. Chemotaxis indices were calculated per plate as follows:
Chemotaxis Index= (# of worms on odorant - # of worms on ethanol) / (total # of worms)
We also reported the percent of worms that failed to choose either odorant as calculated per plate below:
Percent Worms on Rest of Plate= (# of wormsrest of plate)/[total # of worms(odorant+ethanol+rest of plate)] x 100
We define “rest of plate” as worms outside the odorant circles and origin (See 1B for illustration). We tested the naïve preference to highly appetitive concentrations of butanone (0.1%) and diacetyl (1%) as previously reported. Each chemotaxis plate is represented as its own datapoint, with figures comprising five technical replicates per three independent populations for a total of 15 datapoints.
Statistics
All statistics were conducted with GraphPad Prism Software version 11.0.0. Welch's t-test was used to compare chemotactic indices and percent worms on rest of plate as it does not assume equal standard deviations.
","reagents":"Strain table
Strain | Genotype | Source |
Wild-type Bristol | CGC | |
CGC | ||
CGC | ||
5x RB759 | This study | |
This Study |
The Caenorhabditis elegans AKT-1 serine/threonine kinase ortholog, AKT-1, is an extensively studied gene, with 39 distinct phenotypes reported from 87 independent studies (Blackwell et al., 2019; Sternberg et al., 2024; Alliance of Genome Resources Consortium 2024). Both loss-of-function (LoF) mutants and RNAi-based knockdown have been used to study the multifaceted effects of reduced akt-1 function. These manipulations lead to many altered, gross, organismal-level phenotypes including changes in reproduction, movement, and lifespan (Sternberg et al., 2024). AKT-1 also plays a role in both insulin and mTOR signaling which have well-documented effects on neuronal plasticity and behavior across species (Hoeffer and Klann 2010; Graber et al., 2013; Lee 2015; Borrie et al., 2017). The body of work examining the role of AKT-1 in behavior in the worm is presently much smaller than other organismal phenotypes. Previous studies have found that akt-1 mutants exhibit deficits in salt chemotaxis and an increase in risk-taking behaviors (Tomioka et al., 2006; Jiu et al., 2010). However, an important consideration for behavioral studies is that mutants should not exhibit phenotypes that could confound interpretation of changes in behavioral outputs. For chemosensation-based assays, such as those that measure olfactory adaptation and learning and memory, perturbations in a worm's ability to detect an odor may be perceived as a learning or memory deficit rather than impaired olfaction (Colbert and Bargmann 1995; Stetak et al., 2009; Kauffman et al., 2010). This is an important distinction because unreported phenotypes, like chemosensory abnormalities, could lead to false positive results in future studies. Here we report that the commonly used akt-1(ok525) mutant demonstrates previously unreported perturbed chemotaxis behaviors that persist even in a new CRISPR LoF line, which limits the usefulness of akt-1 mutants for many behavioral studies.
Mutation of akt-1 leads to defective chemotaxis
To examine the chemotactic ability of akt-1(ok525) mutants, we used well-established, population-based assays where worms are exposed to an odorant that they have never encountered on an agar plate (Bargmann et al., 1993). While conducting preliminary chemotaxis (CTX) assays using a neutral concentration of butanone (10%), we observed that akt-1(ok525) animals that had not been outcrossed (0x) displayed a deficit compared to control (1A-left). We found that this deficit was due to animals not choosing either odor, represented by a high percentage of animals left on the plate (1A-right), and instead crawling towards the sides and walls of the plate (1B). To determine if the deficit was the result of background mutations or due to the presence of the akt-1 mutation, we outcrossed akt-1(ok525) animals with wild-type worms five times [5x akt-1(ok525)]. We then tested their chemotaxis towards two attractive odors - an attractive concentration of butanone (0.1%, 1C) and diacetyl (1%,1D) to examine this phenotype more robustly. We chose these odorants because they require different sensory neurons, with attractive butanone chemosensation requiring the AWC neuron while attractive diacetyl chemosensation requires the AWA neuron (Bargmann et al., 1993; Wes and Bargmann 2001). We observed deficits in the naïve CTX of the 5x akt-1(ok525) line to both odorants and concomitant increases in percent animals left on the plate, suggesting a broad effect involving many neurons and potentially multiple tissues. Since the deletion in the akt-1(ok525) line is very large (1E), we decided to create a more targeted LoF mutant using CRISPR/Cas9 (Evans 2006; Katic and Großhans 2013; Paix et al., 2015; Dickinson and Goldstein 2016; Schwartz et al., 2021). Briefly, we inserted a stop cassette at the end of the first exon in akt-1(ary2) (1E) and confirmed this edit via whole-genome sequencing (Dickinson and Goldstein 2016; Calarco et al., 2025). We then tested the akt-1(ary2) strain's naïve CTX towards the same strong attractants and again observed a deficit to both odorants and an increase in the number of animals left on the plate (1F-G), similar to the akt-1(ok525) strain. This suggests that genetic loss of akt-1, irrespective of the mutation introduced, is sufficient to drive this abnormal chemotactic behavior.
RNAi knockdown of akt-1 reveals a likely developmental origin of chemotaxis deficits that can be prevented with adult-only RNAi administration
We next sought to establish if knockdown of akt-1 via RNAi could circumvent the abnormal chemotaxis phenotype through more temporal and spatial control of gene manipulation (Zhuang and Hunter 2012). We administered akt-1 RNAi to wild-type animals, which excludes knockdown in neurons, and a neuron-specific RNAi line (sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1], Yang et al., 2024). This RNAi treatment was performed either for the whole-life (WL, from hatch) or in adulthood (adult-only, AO). These conditions would allow us to determine if timing or neuron-specific loss was sufficient to overcome the phenotypes we had observed in mutant strains (1H) (Zhuang and Hunter 2012; Yang et al., 2024). We first fed wild-type worms akt-1 RNAi for their entire life, which would most closely mimic the mutant condition (excluding neurons) to see if the abnormal chemotaxis behaviors would persist. We found that RNAi against akt-1 administered WL in a wild-type background recapitulated our LoF mutants and observed CTX deficits to both butanone (1I) and diacetyl (1L). Since RNAi administration in a wild-type background excludes neurons and produced CTX deficits, we hypothesized that knockdown in only neuronal tissues might not have an effect on CTX behaviors. Utilizing a genetic, neuron-specific strain, we administered WL RNAi against akt-1 and found that knockdown in neurons alone was sufficient to recapitulate the chemotactic deficits and subsequent increase in the percent of worms left on the plate (1J, 1M). This suggests that akt-1 plays an important developmental role in multiple tissues in influencing sensory neuron function and that loss of akt-1 in this critical window manifests in altered adult behaviors. AO administration in previous studies has proven to be a successful way to interrogate a gene's effect on behavior apart from its role in regulating development (Kaletsky et al., 2016; Arey et al., 2019; Hayden et al., 2024; Qin et al., 2025). Interestingly, we found that AO administration of akt-1 in a wild-type background had no detectable effect on chemotaxis to both attractive odorants and resulted in low amounts of worms left on the plate (1K, 1N). These results indicate that the abnormal chemotaxis behaviors described are likely a result of akt-1 influence on development as systemic AO knockdown did not produce similar behaviors.
Limitations and future directions
We have shown that loss of akt-1 throughout development, through either genetic manipulation or RNAi, is sufficient to produce abnormal olfactory chemotaxis behaviors. We also found that AO RNAi administration is sufficient to uncouple the developmental effects of akt-1 from its influence on chemotactic assays. Therefore, future studies investigating akt-1 in phenotypes that include an olfactory sensory component outside the context of development should be sure to use carefully timed knockdown approaches. For this study, we did not employ the auxin-inducible degron (AID) system which is another method offering temporal specificity in knockdowns (Zhang et al, 2015; Ashley et al., 2021). We expect that an akt-1 AID system will behave similarly to the AO RNAi administration line as long as the knockdown is induced after the completion of neuronal development.
","references":[{"reference":"Alliance of Genome Resources Consortium. 2024. Updates to the Alliance of Genome Resources central infrastructure. Genetics 227(1): 10.1093/genetics/iyae049.
","pubmedId":"38552170","doi":""},{"reference":"Arey RN, Kaletsky R, Murphy CT. 2019. Nervous system-wide profiling of presynaptic mRNAs reveals regulators of associative memory. Sci Rep 9(1): 20314.
","pubmedId":"31889133","doi":""},{"reference":"Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, et al., Ward JD. 2021. An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Genetics 217(3): 10.1093/genetics/iyab006.
","pubmedId":"33677541","doi":""},{"reference":"Bargmann CI, Hartwieg E, Horvitz HR. 1993. Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74(3): 515-27.
","pubmedId":"8348618","doi":""},{"reference":"Blackwell TK, Sewell AK, Wu Z, Han M. 2019. TOR Signaling in Caenorhabditis elegans Development, Metabolism, and Aging. Genetics 213(2): 329-360.
","pubmedId":"31594908","doi":""},{"reference":"Borrie SC, Brems H, Legius E, Bagni C. 2017. Cognitive Dysfunctions in Intellectual Disabilities: The Contributions of the Ras-MAPK and PI3K-AKT-mTOR Pathways. Annu Rev Genomics Hum Genet 18: 115-142.
","pubmedId":"28859574","doi":""},{"reference":"Calarco JA, Taylor SR, Miller DM 3rd. 2025. Detecting gene expression in Caenorhabditis elegans. Genetics 229(1): 1-108.
","pubmedId":"39693264","doi":""},{"reference":"Colbert HA, Bargmann CI. 1995. Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14(4): 803-12.
","pubmedId":"7718242","doi":""},{"reference":"Dickinson DJ, Goldstein B. 2016. CRISPR-Based Methods for Caenorhabditis elegans Genome Engineering. Genetics 202(3): 885-901.
","pubmedId":"26953268","doi":""},{"reference":"Evans T. 2006. Transformation and microinjection. WormBook : 10.1895/wormbook.1.108.1.
","pubmedId":"","doi":"10.1895/wormbook.1.108.1"},{"reference":"Graber TE, McCamphill PK, Sossin WS. 2013. A recollection of mTOR signaling in learning and memory. Learn Mem 20(10): 518-30.
","pubmedId":"24042848","doi":""},{"reference":"Hayden AN, Brandel KL, Pietryk EW, Merlau PR, Vijayakumar P, Leptich EJ, et al., Arey RN. 2024. Behavioral screening reveals a conserved residue in Y-Box RNA-binding protein required for associative learning and memory in C. elegans. PLoS Genet 20(10): e1011443.
","pubmedId":"39423228","doi":""},{"reference":"Hoeffer CA, Klann E. 2010. mTOR signaling: at the crossroads of plasticity, memory and disease. Trends Neurosci 33(2): 67-75.
","pubmedId":"19963289","doi":""},{"reference":"Jiu YM, Yue Y, Yang S, Liu L, Yu JW, Wu ZX, Xu T. 2010. Insulin-like signaling pathway functions in integrative response to an olfactory and a gustatory stimuli in Caenorhabditis elegans. Protein Cell 1(1): 75-81.
","pubmedId":"21203999","doi":""},{"reference":"Katic I, Großhans H. 2013. Targeted heritable mutation and gene conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics 195(3): 1173-6.
","pubmedId":"23979578","doi":""},{"reference":"Kaletsky R, Lakhina V, Arey R, Williams A, Landis J, Ashraf J, Murphy CT. 2016. The C. elegans adult neuronal IIS/FOXO transcriptome reveals adult phenotype regulators. Nature 529(7584): 92-6.
","pubmedId":"26675724","doi":""},{"reference":"Kauffman AL, Ashraf JM, Corces-Zimmerman MR, Landis JN, Murphy CT. 2010. Insulin signaling and dietary restriction differentially influence the decline of learning and memory with age. PLoS Biol 8(5): e1000372.
","pubmedId":"20502519","doi":""},{"reference":"Lee DY. 2015. Roles of mTOR Signaling in Brain Development. Exp Neurobiol 24(3): 177-85.
","pubmedId":"26412966","doi":""},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics 201(1): 47-54.
","pubmedId":"26187122","doi":""},{"reference":"Qin C, Liu Z, Duan D, Wu L. 2025. Genome-wide RNAi analysis in adult Caenorhabditis elegans unveils genes controlling age-related fat accumulation. Mech Ageing Dev 226: 112089.
","pubmedId":"40617488","doi":""},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet 17(11): e1009755.
","pubmedId":"34748534","doi":""},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics 227(1): 10.1093/genetics/iyae050.
","pubmedId":"38573366","doi":""},{"reference":"Stetak A, Hörndli F, Maricq AV, van den Heuvel S, Hajnal A. 2009. Neuron-specific regulation of associative learning and memory by MAGI-1 in C. elegans. PLoS One 4(6): e6019.
","pubmedId":"19551147","doi":""},{"reference":"Tomioka M, Adachi T, Suzuki H, Kunitomo H, Schafer WR, Iino Y. 2006. The insulin/PI 3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans. Neuron 51(5): 613-25.
","pubmedId":"16950159","doi":""},{"reference":"Wes PD, Bargmann CI. 2001. C. elegans odour discrimination requires asymmetric diversity in olfactory neurons. Nature 410(6829): 698-701.
","pubmedId":"11287957","doi":""},{"reference":"Yang Y, Arnold ML, Lange CM, Sun LH, Broussalian M, Doroodian S, et al., Hansen M. 2024. Autophagy protein ATG-16.2 and its WD40 domain mediate the beneficial effects of inhibiting early-acting autophagy genes in C. elegans neurons. Nat Aging 4(2): 198-212.
","pubmedId":"38177330","doi":""},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142(24): 4374-84.
","pubmedId":"26552885","doi":""},{"reference":"Zhuang JJ, Hunter CP. 2012. RNA interference in Caenorhabditis elegans: uptake, mechanism, and regulation. Parasitology 139(5): 560-73.
","pubmedId":"22075748","doi":""}],"title":"Loss of akt-1 throughout development leads to abnormal chemosensory behaviors in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":"1793382960651"}]},{"id":"469a2e86-0820-474e-8267-0bbfc84e1457","decision":"publish","abstract":"The C. elegans AKT serine/threonine kinase AKT-1 is widely studied because it is a molecular player in multiple ubiquitous signaling pathways. akt-1 mutants have been associated with gross, organismal-level phenotypes. In addition to organismal physiology, pathways associated with akt-1 are known to regulate neuronal plasticity and behavior; therefore, akt-1 mutants could be valuable for behavioral characterization. Here, we report that akt-1 loss-of-function mutants demonstrate perturbed chemotaxis behaviors which could confound experiments that rely on proper chemosensation. We also determined that adult-only administration of akt-1 RNAi is sufficient to overcome these behavioral deficits, suggesting these defects are likely developmental in origin.
","acknowledgements":"Some strains were provided by the CGC, which is funded by NIH Office of Research Infrastructure Programs (P40 OD010440). We thank Dr. Andrea Stavoe for her aid and guidance with akt-1 CRISPR KO design.
","authors":[{"affiliations":["Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health"],"credit":["conceptualization","formalAnalysis","investigation","methodology","writing_originalDraft","writing_reviewEditing"],"email":"Meredith.Williams@bcm.edu","firstName":"Meredith I","lastName":"Williams","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Department of Neuroscience","Department of Pathology and Immunology"],"credit":["investigation","writing_reviewEditing"],"email":"Hope.Msengi@bcm.edu","firstName":"Hope","lastName":"Msengi","submittingAuthor":false,"correspondingAuthor":false,"equalContribution":false,"WBId":null,"orcid":null},{"affiliations":["Baylor College of Medicine, Houston, TX, United States","Baylor College of Medicine, Houston, TX, United States"],"departments":["Center for Precision Environmental Health","Department of Molecular and Cellular Biology"],"credit":["conceptualization","fundingAcquisition","investigation","methodology","writing_reviewEditing","writing_originalDraft"],"email":"rachel.arey@bcm.edu","firstName":"Rachel","lastName":"Arey","submittingAuthor":true,"correspondingAuthor":true,"equalContribution":false,"WBId":null,"orcid":"0000-0001-9941-3945"}],"awards":[{"awardId":"DP2NS132372","funderName":"National Institutes of Health (United States)","awardRecipient":"Rachel N Arey"}],"conflictsOfInterest":"The authors declare that there are no conflicts of interest present.
","dataTable":{"url":null},"extendedData":[],"funding":"This work was supported by NIH Office of the Director (OD; DP2NS132372) to Rachel N Arey.
","image":{"url":"https://portal.micropublication.org/uploads/5b5bd7263b9ed2c1726b435db9b44985.jpg"},"imageCaption":"A) 0x outcrossed akt-1(ok525) mutants have abnormally low chemotaxis indices to 10% butanone, due to large percentage of worms distributed around the chemotaxis plate. p-value= <0.0001. n = 15 assay plates. B) Schematic of akt-1 phenotype observed during the chemotaxis assay. C,D). After 5 rounds (5x) of outcrossing, abnormal chemotaxis behaviors are observed towards strong attractants 0.1% butanone (C) and 1% diacetyl (D) in akt-1(ok525) mutants. p-value= <0.0001. n = 15 assay plates. E) Schematic of akt-1(ok525) allele and new akt-1(ary2) allele generated by CRISPR. F,G). akt-1(ary2) worms exhibit same abnormal chemotaxis behaviors as akt-1(ok525) animals towards strong attractants 0.1% butanone (F) and 1% diacetyl (G). p-value= <0.0001. n = 15 assay plates. H) Schematic of timelines of different RNAi administration to knockdown akt-1 in specific tissues and different developmental timepoints. I,J). Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 0.1% butanone in both wild-type (I, p-value = 0.0012) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (J, p-value<0.001) animals. n = 15 assay plates. K). Wild-type animals receiving adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 0.1% butanone. p-value of worms on plate = 0.0490. n = 15 assay plates. L,M) Whole-life administration of akt-1 RNAi results in abnormal chemotaxis behaviors towards strong attractant 1% diacetyl in both wild-type (L, p-value < 0.0013, <0.0001) or neuronally-sensitive sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1] (M, p-value<0.0001) animals. n = 15 assay plates. N) Wild-type animals receiving adult-only akt-1 RNAi administration no longer display severely abnormal chemotaxis behaviors towards 1% butanone diacetyl. n = 15 assay plates.
","imageTitle":"Loss of akt-1 throughout development via mutation or RNAi knockdown causes defective olfactory chemotaxis that can be avoided with adult-only manipulations
","methods":"General C. elegans strains and maintenance
All C. elegans strains were kept at 20°C on either standard nematode growth medium (NGM) plates or NGM plates containing 50ug/mL Carbenicillin and 1.0mM IPTG, referred to as NGICs. Plates were seeded with OP50 Escherichia coli or HT115 bacteria expressing akt-1 RNAi (Clone purchased from Horizon; Catalog #RCE1182-202292360) or vector RNAi. Animals were developmentally synchronized using an alkaline-bleach solution on a population of gravid adults for egg collection; eggs were then washed with M9 buffer solution three times before plating on NGMs or NGICs. A list of the strains used and generated in this study are listed in the reagents section below.
Strain development
akt-1(ary2) was generated via CRISPR/Cas9 genome editing and the gRNA and HDR template are listed below. Briefly, a stop codon cassette was inserted at the end of the first exon. The CRISPR/Cas9 injection, screening, and confirmation genotyping were conducted according to previous work. Whole genome sequencing was conducted through the University of Minnesota Model Organism Sequencing Core and confirmed our desired edit and no off-target effects.
gRNA (+ strand):
ACAUUCGAAACUGGAGACCAGUUUUAGAGCUAUGCU
HDR (- strand):
G*T*G GTA ATA TAT GAT CAG TAC CGA TAG AAA AAT CAA ACC TGC TAG CTT ATC ACT TAG TCA CCT CTG CTC TGG ACA AAC ТТС ССС ТАТ СТC CAG TTT CGA ATG TGC ТСТ ССТ ТTC TTG TGA AGC C*A*T
RNAi Treatment
For whole-life RNAi exposure, bleached eggs were immediately plated onto NGICs seeded with HT115 bacteria expressing either vector or akt-1 RNAi (Horizon) and tested for behavior on day one of adulthood. For adult-only RNAi exposure, bleached eggs were plated onto NGM plates seeded with OP50 E. coli. At the L4 stage, worms were washed three times with M9 buffer solution before being transferred to seeded NGICs. Worms were exposed to RNAi for 48 hours before testing on day two of adulthood.
Naïve Chemotaxis Assay
Chemotaxis assays were performed as previously described (Bargmann et al., 1993). Briefly, assays were performed on unseeded 100mm NGM plates with two circles on opposite sides drawn approximately 5mm from the edge (See 1B for illustration). 1uL of sodium azide was placed in the middle of both circles and dried before adding 1uL of odorant diluted in ethanol to the top left circle and 1uL of ethanol to the top right circle (1B). Well-fed, synchronized adult populations were washed into a conical tube using M9 buffer solution and washed three times to remove any residual food. Using a wide-bore pipette tip, worms were then placed near the bottom center circle (1B), or origin, of the plate and allowed to chemotax for an hour. Chemotaxis indices were calculated per plate as follows:
Chemotaxis Index= (# of worms on odorant - # of worms on ethanol) / (total # of worms)
We also reported the percent of worms that failed to choose either odorant as calculated per plate below:
Percent Worms on Rest of Plate= (# of wormsrest of plate)/[total # of worms(odorant+ethanol+rest of plate)] x 100
We define “rest of plate” as worms outside the odorant circles and origin (See 1B for illustration). We tested the naïve preference to highly appetitive concentrations of butanone (0.1%) and diacetyl (1%) as previously reported. Each chemotaxis plate is represented as its own datapoint, with figures comprising five technical replicates per three independent populations for a total of 15 datapoints.
Statistics
All statistics were conducted with GraphPad Prism Software version 11.0.0. Welch's t-test was used to compare chemotactic indices and percent worms on rest of plate as it does not assume equal standard deviations.
","reagents":"Strain table
Strain | Genotype | Source |
Wild-type Bristol | CGC | |
CGC | ||
CGC | ||
5x RB759 | This study | |
This Study |
The Caenorhabditis elegans AKT-1 serine/threonine kinase ortholog, AKT-1, is an extensively studied gene, with 39 distinct phenotypes reported from 87 independent studies (Blackwell et al., 2019; Sternberg et al., 2024; Alliance of Genome Resources Consortium 2024). Both loss-of-function (LoF) mutants and RNAi-based knockdown have been used to study the multifaceted effects of reduced akt-1 function. These manipulations lead to many altered, gross, organismal-level phenotypes including changes in reproduction, movement, and lifespan (Sternberg et al., 2024). AKT-1 also plays a role in both insulin and mTOR signaling, which have well-documented effects on neuronal plasticity and behavior across species (Hoeffer and Klann 2010; Graber et al., 2013; Lee 2015; Borrie et al., 2017). The body of work examining the role of AKT-1 in behavior in the worm is presently much smaller than other organismal phenotypes. Previous studies have found that akt-1 mutants exhibit deficits in salt chemotaxis and an increase in risk-taking behaviors (Tomioka et al., 2006; Jiu et al., 2010). However, an important consideration for behavioral studies is that mutants should not exhibit phenotypes that could confound interpretation of changes in behavioral outputs. For chemosensation-based assays, such as those that measure olfactory adaptation and learning and memory, perturbations in a worm's ability to detect an odor may be perceived as a learning or memory deficit rather than impaired olfaction (Colbert and Bargmann 1995; Stetak et al., 2009; Kauffman et al., 2010). This is an important distinction because unreported phenotypes, like chemosensory abnormalities, could lead to false positive results in future studies. Here we report that the commonly used akt-1(ok525) mutant demonstrates previously unreported perturbed chemotaxis behaviors that persist even in a new CRISPR LoF line, which limits the usefulness of akt-1 mutants for many behavioral studies.
Mutation of akt-1 leads to defective chemotaxis
To examine the chemotactic ability of akt-1(ok525) mutants, we used well-established, population-based assays where worms are exposed to an odorant that they have never encountered on an agar plate (Bargmann et al., 1993). While conducting preliminary chemotaxis (CTX) assays using a neutral concentration of butanone (10%), we observed that akt-1(ok525) animals that had not been outcrossed (0x) displayed a deficit compared to control (1A-left). We found that this deficit was due to animals not choosing either odor, represented by a high percentage of animals left on the plate (1A-right), and instead crawling towards the sides and walls of the plate (1B). To determine if the deficit was the result of background mutations or due to the presence of the akt-1 mutation, we outcrossed akt-1(ok525) animals with wild-type worms five times [5x akt-1(ok525)]. We then tested their chemotaxis towards two attractive odors - an attractive concentration of butanone (0.1%, 1C) and diacetyl (1%,1D) to examine this phenotype more robustly. We chose these odorants because they require different sensory neurons, with attractive butanone chemosensation requiring the AWC neuron while attractive diacetyl chemosensation requires the AWA neuron (Bargmann et al., 1993; Wes and Bargmann 2001). We observed deficits in the naïve CTX of the 5x akt-1(ok525) line to both odorants and concomitant increases in percent animals left on the plate, suggesting a broad effect involving many neurons and potentially multiple tissues. Since the deletion in the akt-1(ok525) line is very large (1E), we decided to create a more targeted LoF mutant using CRISPR/Cas9 (Evans 2006; Katic and Großhans 2013; Paix et al., 2015; Dickinson and Goldstein 2016; Schwartz et al., 2021). Briefly, we inserted a stop cassette at the end of the first exon in akt-1(ary2) (1E) and confirmed this edit via whole-genome sequencing (Dickinson and Goldstein 2016; Calarco et al., 2025). We then tested the akt-1(ary2) strain's naïve CTX towards the same strong attractants and again observed a deficit to both odorants and an increase in the number of animals left on the plate (1F-G), similar to the akt-1(ok525) strain. This suggests that genetic loss of akt-1, irrespective of the mutation introduced, is sufficient to drive this abnormal chemotactic behavior.
RNAi knockdown of akt-1 reveals a likely developmental origin of chemotaxis deficits that can be prevented with adult-only RNAi administration
We next sought to establish if knockdown of akt-1 via RNAi could circumvent the abnormal chemotaxis phenotype through more temporal and spatial control of gene manipulation (Zhuang and Hunter 2012). We administered akt-1 RNAi to wild-type animals, which excludes knockdown in neurons, and a neuron-specific RNAi line (sid-1 [qt9] V; sqls71[rgef-1::GFP + rgef-1p::sid-1], Yang et al., 2024). This RNAi treatment was performed either for the whole-life (WL, from hatch) or in adulthood (adult-only, AO). These conditions would allow us to determine if timing or neuron-specific loss was sufficient to overcome the phenotypes we had observed in mutant strains (1H) (Zhuang and Hunter 2012; Yang et al., 2024). We first fed wild-type worms akt-1 RNAi for their entire life, which would most closely mimic the mutant condition (excluding neurons) to see if the abnormal chemotaxis behaviors would persist. We found that RNAi against akt-1 administered WL in a wild-type background recapitulated our LoF mutants and observed CTX deficits to both butanone (1I) and diacetyl (1L). Since RNAi administration in a wild-type background excludes neurons and produced CTX deficits, we hypothesized that knockdown in only neuronal tissues might not have an effect on CTX behaviors. Utilizing a genetic, neuron-specific strain, we administered WL RNAi against akt-1 and found that knockdown in neurons alone was sufficient to recapitulate the chemotactic deficits and subsequent increase in the percent of worms left on the plate (1J, 1M). This suggests that akt-1 plays an important developmental role in multiple tissues in influencing sensory neuron function and that loss of akt-1 in this critical window manifests in altered adult behaviors. AO administration in previous studies has proven to be a successful way to interrogate a gene's effect on behavior apart from its role in regulating development (Kaletsky et al., 2016; Arey et al., 2019; Hayden et al., 2024; Qin et al., 2025). Interestingly, we found that AO administration of akt-1 in a wild-type background had no detectable effect on chemotaxis to both attractive odorants and resulted in low amounts of worms left on the plate (1K, 1N). These results indicate that the abnormal chemotaxis behaviors described are likely a result of akt-1's influence on development as systemic AO knockdown did not produce similar behaviors.
Limitations and future directions
We have shown that loss of akt-1 throughout development, through either genetic manipulation or RNAi, is sufficient to produce abnormal olfactory chemotaxis behaviors. We also found that AO RNAi administration is sufficient to uncouple the developmental effects of akt-1 from its influence on chemotactic assays. Therefore, future studies investigating akt-1 in phenotypes that include an olfactory sensory component outside the context of development should be sure to use carefully timed knockdown approaches. For this study, we did not employ the auxin-inducible degron (AID) system which is another method offering temporal specificity in knockdowns (Zhang et al, 2015; Ashley et al., 2021). We expect that an akt-1 AID system will behave similarly to the AO RNAi administration line as long as the knockdown is induced after the completion of neuronal development.
","references":[{"reference":"Alliance of Genome Resources Consortium. 2024. Updates to the Alliance of Genome Resources central infrastructure. Genetics 227(1): 10.1093/genetics/iyae049.
","pubmedId":"38552170","doi":""},{"reference":"Arey RN, Kaletsky R, Murphy CT. 2019. Nervous system-wide profiling of presynaptic mRNAs reveals regulators of associative memory. Sci Rep 9(1): 20314.
","pubmedId":"31889133","doi":""},{"reference":"Ashley GE, Duong T, Levenson MT, Martinez MAQ, Johnson LC, Hibshman JD, et al., Ward JD. 2021. An expanded auxin-inducible degron toolkit for Caenorhabditis elegans. Genetics 217(3): 10.1093/genetics/iyab006.
","pubmedId":"33677541","doi":""},{"reference":"Bargmann CI, Hartwieg E, Horvitz HR. 1993. Odorant-selective genes and neurons mediate olfaction in C. elegans. Cell 74(3): 515-27.
","pubmedId":"8348618","doi":""},{"reference":"Blackwell TK, Sewell AK, Wu Z, Han M. 2019. TOR Signaling in Caenorhabditis elegans Development, Metabolism, and Aging. Genetics 213(2): 329-360.
","pubmedId":"31594908","doi":""},{"reference":"Borrie SC, Brems H, Legius E, Bagni C. 2017. Cognitive Dysfunctions in Intellectual Disabilities: The Contributions of the Ras-MAPK and PI3K-AKT-mTOR Pathways. Annu Rev Genomics Hum Genet 18: 115-142.
","pubmedId":"28859574","doi":""},{"reference":"Calarco JA, Taylor SR, Miller DM 3rd. 2025. Detecting gene expression in Caenorhabditis elegans. Genetics 229(1): 1-108.
","pubmedId":"39693264","doi":""},{"reference":"Colbert HA, Bargmann CI. 1995. Odorant-specific adaptation pathways generate olfactory plasticity in C. elegans. Neuron 14(4): 803-12.
","pubmedId":"7718242","doi":""},{"reference":"Dickinson DJ, Goldstein B. 2016. CRISPR-Based Methods for Caenorhabditis elegans Genome Engineering. Genetics 202(3): 885-901.
","pubmedId":"26953268","doi":""},{"reference":"Evans T. 2006. Transformation and microinjection. WormBook : 10.1895/wormbook.1.108.1.
","pubmedId":"","doi":"10.1895/wormbook.1.108.1"},{"reference":"Graber TE, McCamphill PK, Sossin WS. 2013. A recollection of mTOR signaling in learning and memory. Learn Mem 20(10): 518-30.
","pubmedId":"24042848","doi":""},{"reference":"Hayden AN, Brandel KL, Pietryk EW, Merlau PR, Vijayakumar P, Leptich EJ, et al., Arey RN. 2024. Behavioral screening reveals a conserved residue in Y-Box RNA-binding protein required for associative learning and memory in C. elegans. PLoS Genet 20(10): e1011443.
","pubmedId":"39423228","doi":""},{"reference":"Hoeffer CA, Klann E. 2010. mTOR signaling: at the crossroads of plasticity, memory and disease. Trends Neurosci 33(2): 67-75.
","pubmedId":"19963289","doi":""},{"reference":"Jiu YM, Yue Y, Yang S, Liu L, Yu JW, Wu ZX, Xu T. 2010. Insulin-like signaling pathway functions in integrative response to an olfactory and a gustatory stimuli in Caenorhabditis elegans. Protein Cell 1(1): 75-81.
","pubmedId":"21203999","doi":""},{"reference":"Katic I, Großhans H. 2013. Targeted heritable mutation and gene conversion by Cas9-CRISPR in Caenorhabditis elegans. Genetics 195(3): 1173-6.
","pubmedId":"23979578","doi":""},{"reference":"Kaletsky R, Lakhina V, Arey R, Williams A, Landis J, Ashraf J, Murphy CT. 2016. The C. elegans adult neuronal IIS/FOXO transcriptome reveals adult phenotype regulators. Nature 529(7584): 92-6.
","pubmedId":"26675724","doi":""},{"reference":"Kauffman AL, Ashraf JM, Corces-Zimmerman MR, Landis JN, Murphy CT. 2010. Insulin signaling and dietary restriction differentially influence the decline of learning and memory with age. PLoS Biol 8(5): e1000372.
","pubmedId":"20502519","doi":""},{"reference":"Lee DY. 2015. Roles of mTOR Signaling in Brain Development. Exp Neurobiol 24(3): 177-85.
","pubmedId":"26412966","doi":""},{"reference":"Paix A, Folkmann A, Rasoloson D, Seydoux G. 2015. High Efficiency, Homology-Directed Genome Editing in Caenorhabditis elegans Using CRISPR-Cas9 Ribonucleoprotein Complexes. Genetics 201(1): 47-54.
","pubmedId":"26187122","doi":""},{"reference":"Qin C, Liu Z, Duan D, Wu L. 2025. Genome-wide RNAi analysis in adult Caenorhabditis elegans unveils genes controlling age-related fat accumulation. Mech Ageing Dev 226: 112089.
","pubmedId":"40617488","doi":""},{"reference":"Schwartz ML, Davis MW, Rich MS, Jorgensen EM. 2021. High-efficiency CRISPR gene editing in C. elegans using Cas9 integrated into the genome. PLoS Genet 17(11): e1009755.
","pubmedId":"34748534","doi":""},{"reference":"Sternberg PW, Van Auken K, Wang Q, Wright A, Yook K, Zarowiecki M, et al., Stein L. 2024. WormBase 2024: status and transitioning to Alliance infrastructure. Genetics 227(1): 10.1093/genetics/iyae050.
","pubmedId":"38573366","doi":""},{"reference":"Stetak A, Hörndli F, Maricq AV, van den Heuvel S, Hajnal A. 2009. Neuron-specific regulation of associative learning and memory by MAGI-1 in C. elegans. PLoS One 4(6): e6019.
","pubmedId":"19551147","doi":""},{"reference":"Tomioka M, Adachi T, Suzuki H, Kunitomo H, Schafer WR, Iino Y. 2006. The insulin/PI 3-kinase pathway regulates salt chemotaxis learning in Caenorhabditis elegans. Neuron 51(5): 613-25.
","pubmedId":"16950159","doi":""},{"reference":"Wes PD, Bargmann CI. 2001. C. elegans odour discrimination requires asymmetric diversity in olfactory neurons. Nature 410(6829): 698-701.
","pubmedId":"11287957","doi":""},{"reference":"Yang Y, Arnold ML, Lange CM, Sun LH, Broussalian M, Doroodian S, et al., Hansen M. 2024. Autophagy protein ATG-16.2 and its WD40 domain mediate the beneficial effects of inhibiting early-acting autophagy genes in C. elegans neurons. Nat Aging 4(2): 198-212.
","pubmedId":"38177330","doi":""},{"reference":"Zhang L, Ward JD, Cheng Z, Dernburg AF. 2015. The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142(24): 4374-84.
","pubmedId":"26552885","doi":""},{"reference":"Zhuang JJ, Hunter CP. 2012. RNA interference in Caenorhabditis elegans: uptake, mechanism, and regulation. Parasitology 139(5): 560-73.
","pubmedId":"22075748","doi":""}],"title":"Loss of akt-1 throughout development leads to abnormal chemosensory behaviors in C. elegans
","reviews":[],"curatorReviews":[{"curator":{"displayName":"KJ Yook"},"openAcknowledgement":false,"submitted":null},{"curator":{"displayName":"Gary Craig Schindelman"},"openAcknowledgement":false,"submitted":null}]}]}},"species":{"species":[{"value":"acer saccharum","label":"Acer saccharum","imageSrc":"","imageAlt":"","mod":"TreeGenes","modLink":"https://treegenesdb.org","linkVariable":""},{"value":"achillea millefolium","label":"Achillea millefolium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"acinetobacter baylyi","label":"Acinetobacter baylyi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"actinobacteria bacterium","label":"Actinobacteria bacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adelges tsugae","label":"Adelges tsugae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"adenocaulon chilense","label":"Adenocaulon chilense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aedes japonicus","label":"Aedes japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aegorhinus vitulus","label":"Aegorhinus vitulus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aerococcus","label":"Aerococcus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alaimidae","label":"Alaimidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"allobates femoralis","label":"Allobates femoralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alnus glutinosa","label":"Alnus glutinosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa aestivalis","label":"Alosa aestivalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alosa pseudoharengus","label":"Alosa pseudoharengus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"alternaria alternata","label":"Alternaria alternata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"amynthas agrestis","label":"Amynthas Agrestis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma caninum","label":"Ancylostoma caninum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ancylostoma ceylanicum","label":"Ancylostoma ceylanicum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anemone multifida","label":"Anemone multifida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anguilla rostrata","label":"Anguilla rostrata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anisakis simplex","label":"Anisakis simplex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anomala albopilosa","label":"Anomala albopilosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"anthomyiidae sp","label":"Anthomyiidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arabidopsis","label":"Arabidopsis","imageSrc":"arabidopsis.png","imageAlt":"Arabidopsis graphic by Zoe Zorn CC BY 4.0","mod":"TAIR","modLink":"https://arabidopsis.org","linkVariable":""},{"value":"architeuthis dux","label":"Architeuthis dux","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arion vulgaris","label":"Arion vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"armeria","label":"Armeria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"artemia","label":"Artemia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"arthrobacter sp.","label":"Arthrobacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia","label":"Ascaridia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ascaridia galli","label":"Ascaridia galli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"asparagopsis taxiformis","label":"Asparagopsis taxiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"astatotilapia burtoni","label":"Astatotilapia burtoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"avena sativa","label":"Avena sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"aves","label":"Aves","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus","label":"Bacillus (firmicutes)","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus cereus","label":"Bacillus cereus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus mycoides","label":"Bacillus mycoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus subtilis","label":"Bacillus subtilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus thuringiensis","label":"Bacillus thuringiensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus toyonensis","label":"Bacillus toyonensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacillus wiedmannii","label":"Bacillus wiedmannii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteria","label":"Bacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bacteriophage","label":"Bacteriophage","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bactrocera","label":"Bactrocera sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"batrachospermum gelatinosum","label":"Batrachospermum gelatinosum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula lenta","label":"Betula lenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"betula nigra","label":"Betula nigra","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus dahlbohmii","label":"Bombus dahlbohmii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombus terrestris","label":"Bombus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bombyx mori","label":"Bombyx mori","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bos taurus","label":"Bos Taurus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brachygobius doriae","label":"Brachygobius doriae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica oleracea","label":"Brassica oleracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brassica rapa","label":"Brassica rapa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"brugia malayi","label":"Brugia malayi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"burkholderia thailandensis","label":"Burkholderia thailandensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"buttiauxella","label":"Buttiauxella","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis brenneri","label":"Caenorhabditis brenneri","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis briggsae","label":"Caenorhabditis briggsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"c. elegans","label":"Caenorhabditis elegans","imageSrc":"c-elegans.jpg","imageAlt":"C. elegans graphic by Zoe Zorn CC BY 4.0","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"caenorhabditis inopinata","label":"Caenorhabditis inopinata","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis japonica","label":"Caenorhabditis japonica","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis nigoni","label":"Caenorhabditis nigoni","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caenorhabditis remanei","label":"Caenorhabditis remanei","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"caenorhabditis tropicalis","label":"Caenorhabditis tropicalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus","label":"Calidifontibacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calidifontibacillus erzuremensis","label":"Calidifontibacillus erzuremensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"calliphora sp","label":"Calliphora sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caltha sagittata","label":"Caltha sagittata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cambarus latimanus","label":"Cambarus latimanus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"candida albicans","label":"Candida albicans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"canis familiaris","label":"Canis familiaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cannabis sativa","label":"Cannabis sativa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caretta caretta","label":"Caretta caretta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cassiopea xamachana","label":"Cassiopea xamachana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"caulobacter vibrioides","label":"Caulobacter vibrioides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cephalopods","label":"Cephalopoda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cerastium arvense","label":"Cerastium arvense","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceriodaphnia","label":"Ceriodaphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ceroglossus suturalis","label":"Ceroglossus suturalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chaetoceros","label":"Chaetoceros","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chamaecrista fasciculata","label":"Chamaecrista fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chilicola chalcidiformis","label":"Chilicola chalcidiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chitinimonas","label":"Chitinimonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chlamydomonas reinhardtii","label":"Chlamydomonas reinhardtii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chromobacterium","label":"Chromobacterium","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysemys picta","label":"Chrysemys picta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"chrysoperla rufilabris","label":"Chrysoperla rufilabris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"citrus","label":"Citrus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"clavibacter sp.","label":"Clavibacter sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"colinus virginianus","label":"Colinus virginianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crassostrea virginica","label":"Crassostrea virginica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"crithidia fasciculata","label":"Crithidia fasciculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cutibacterium acnes","label":"Cutibacterium acnes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"cyanobacteria","label":"Cyanobacteria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia","label":"Daphnia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"daphnia pulex","label":"Daphnia pulex","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dermacoccus nishinomiyaensis","label":"Dermacoccus nishinomiyaensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera","label":"Diabrotica virgifera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"diabrotica virgifera virgifera virus 1","label":"Diabrotica virgifera virgifera virus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"d. discoideum","label":"Dictyostelium discoideum","imageSrc":"dicty.png","imageAlt":"D. discoideum","mod":"dictyBase","modLink":"http://dictybase.org","linkVariable":""},{"value":"diptera","label":"Diptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dotocryptus bellicosus","label":"Dotocryptus bellicosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drechmeria coniospora","label":"Drechmeria coniospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"drosophila","label":"Drosophila","imageSrc":"drosophila.png","imageAlt":"Drosophila graphic by Zoe Zorn CC BY 4.0","mod":"FlyBase","modLink":"https://flybase.org/doi/","linkVariable":"doi"},{"value":"dryopteris campyloptera","label":"Dryopteris campyloptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris expansa","label":"Dryopteris expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dryopteris intermedia","label":"Dryopteris intermedia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"dugesia dorotocephala","label":"Dugesia dorotocephala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"elasmobranchii","label":"Elasmobranchii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"embryophyta","label":"Embryophyta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enoploteuthis chunii","label":"Enoploteuthis chunii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterobacter aerogenes","label":"Enterobacter aerogenes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"enterococcus raffinosus","label":"Enterococcus raffinosus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"epichloë coenophiala","label":"Epichloë coenophiala","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"equus caballus","label":"Equus caballus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erigeron sp","label":"Erigeron sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eristalis","label":"Eristalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eruca vesicaria","label":"Eruca vesicaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erwinia carotovora","label":"Erwinia carotovora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"erythronium americanum","label":"Erythronium americanum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"escherichia coli","label":"Escherichia coli","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"eukaryota","label":"Eukaryotes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"felis catus","label":"Felis catus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella novicida","label":"Francisella novicida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"francisella tularensis","label":"Francisella tularensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fraxinus americana","label":"Fraxinus americana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fucus distichus","label":"Fucus distichus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"fungi","label":"Fungi","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gasteropelecus sp.","label":"Gasteropelecus sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"geranium sp","label":"Geranium sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"girardia","label":"Girardia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glaucomys volans","label":"Glaucomys volans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"glycine max","label":"Glycine max","imageSrc":"","imageAlt":"","mod":"Soybase","modLink":"https://soybase.org","linkVariable":""},{"value":"glyptemys insculpta","label":"Glyptemys insculpta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gossypium hirsutum","label":"Gossypium hirsutum","imageSrc":"","imageAlt":"","mod":"CottonGen","modLink":"https://www.cottongen.org/","linkVariable":""},{"value":"gromphadorhina portentosa","label":"Gromphadorhina portentosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"gryllodes sigillatus","label":"Gryllodes sigillatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"haliotis rufescens","label":"Haliotis rufescens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hepacivirus hominis","label":"Hepatitis C Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"herpes simplex virus type 1","label":"Herpes simplex virus type 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human","label":"Human","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"human coronavirus oc43","label":"Human coronavirus OC43","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydra vulgaris","label":"Hydra vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hydropsyche sp","label":"Hydropsyche sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hymenoptera","label":"Hymenoptera","imageSrc":"","imageAlt":"","mod":"Hymenoptera Genome Database","modLink":"https://hymenoptera.elsiklab.missouri.edu/","linkVariable":""},{"value":"hypochaeris radicata","label":"Hypochaeris radicata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"hypodynerus vespiformis","label":"Hypodynerus vespiformis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflaviridae","label":"Iflaviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"iflavuris","label":"Iflavirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ipomoea hederacea","label":"Ipomoea hederacea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera","label":"Ischnomera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ischnomera ruficollis","label":"Ischnomera ruficollis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"julidochromis marlieri","label":"Julidochromis marlieri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"juniperus virginiana","label":"Juniperus virginiana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"kluyveromyces marxianus","label":"Kluyveromyces marxianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"l. casei","label":"L. casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lacticaseibacillus casei","label":"Lacticaseibacillus casei","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lactobacillus","label":"Lactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"larentiinae sp","label":"Larentiinae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"laurus nobilis","label":"Laurus nobilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lepidoptera","label":"Lepidoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"leucanthemum vulgare","label":"Leucanthemum vulgare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus","label":"Ligilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ligilactobacillus salivarius","label":"Ligilactobacillus salivarius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"limosilactobacillus","label":"Limosilactobacillus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"linepithema humile","label":"Linepithema humile","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"liometopum occidentale","label":"Liometopum occidentale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lolium arundinaceum","label":"Lolium arundinaceum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lontra longicaudis","label":"Lontra longicaudis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbriculus variegatus","label":"Lumbriculus variegatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lumbricus terrestris","label":"Lumbricus terrestris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lupinus polyphyllus","label":"Lupinus polyphyllus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lycorma delicatula","label":"Lycorma delicatula","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"lynx rufus","label":"Lynx rufus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"magnaporthe oryzae","label":"Magnaporthe oryzae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mammalia","label":"Mammalia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"manihot esculenta","label":"Manihot esculenta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"medicago lupulina","label":"Medicago lupulina","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"meloidogyne","label":"Meloidogyne","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mimus polyglottos","label":"Mimus polyglottos","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"bryophyta","label":"Mosses","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mouse","label":"Mouse","imageSrc":"","imageAlt":"","mod":"MGI","modLink":"https://informatics.jax.org","linkVariable":""},{"value":"m. minutoides","label":"Mus minutoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"mycobacterium smegmatis","label":"Mycobacterium smegmatis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nakaseomyces glabratus","label":"Nakaseomyces glabratus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nauphoeta cinerea","label":"Nauphoeta cinerea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"neurospora","label":"Neurospora","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"n. benthamiana","label":"Nicotiana benthamiana","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/Nicotiana_benthamiana/genome","linkVariable":""},{"value":"nicotiana tabacum","label":"Nicotiana tabacum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae","label":"Noctuidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"noctuidae sp","label":"Noctuidae sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"nothobranchius furzeri","label":"Nothobranchius furzeri","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"onchocerca volvulus","label":"Onchocerca volvulus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"orconectes virilis","label":"Orconectes virilis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ormia ochracea","label":"Ormia ochracea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"o. sativa","label":"Oryza sativa","imageSrc":"","imageAlt":"","mod":"Gramene","modLink":"https://www.gramene.org/","linkVariable":""},{"value":"other","label":"Other","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"oxalis enneaphylla","label":"Oxalis enneaphylla","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paenarthrobacter nicotinovorans","label":"Paenarthrobacter nicotinovorans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea","label":"Pantoea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pantoea agglomerans","label":"Pantoea agglomerans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"papaver sp","label":"Papaver sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"paramecium bursaria","label":"Paramecium bursaria","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"partitiviridae","label":"Partitiviridae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pelodiscus sinensis","label":"Pelodiscus sinensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"perezia recurvata","label":"Perezia recurvata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"petromyzon marinus","label":"Petromyzon marinus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis","label":"Photinus pyralis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis associated partiti-like virus","label":"Photinus pyralis associated partiti-like virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"photinus pyralis iflavirus 1","label":"Photinus pyralis iflavirus 1","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"physcomitrium patens","label":"Physcomitrium patens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus strobus","label":"Pinus strobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pinus taeda","label":"Pinus taeda","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"platycheirus","label":"Platycheirus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"plectus sambesii","label":"Plectus sambesii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pogonomyrmex occidentalis","label":"Pogonomyrmex occidentalis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"poncirus trifoliata","label":"Poncirus trifoliata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"populus deltoides","label":"Populus deltoides","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"potato virus y","label":"Potato virus Y","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"primula magellanica","label":"Primula magellanica","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pristionchus pacificus","label":"Pristionchus pacificus","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"prunus persica","label":"Prunus persica","imageSrc":"","imageAlt":"","mod":"Genome Database for Rosaceae","modLink":"https://www.rosaceae.org/","linkVariable":""},{"value":"psalmopoeus iriminia","label":"Psalmopoeus iriminia","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudanabaena sp.","label":"Pseudanabaena sp.","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas","label":"Pseudomonas","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas aeruginosa","label":"Pseudomonas aeruginosa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas glycinae","label":"Pseudomonas glycinae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas putida","label":"Pseudomonas putida","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pseudomonas syringae","label":"Pseudomonas syringae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"pterophyllum scalare","label":"Pterophyllum scalare","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"python regius","label":"Python regius","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"quercus macrocarpa","label":"Quercus macrocarpa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ralstonia solanacearum","label":"Ralstonia solanacearum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranitomeya imitator","label":"Ranitomeya imitator","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ranunculus peduncularis","label":"Ranunculus peduncularis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"rat","label":"Rat","imageSrc":"","imageAlt":"","mod":"RGD","modLink":"https://rgd.mcw.edu","linkVariable":""},{"value":"rheinheimera","label":"Rheinheimera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ribes rubrum","label":"Ribes rubrum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"sars-cov-2","label":"SARS-CoV-2","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. cerevisiae","label":"Saccharomyces cerevisiae","imageSrc":"yeast.png","imageAlt":"Yeast graphic by Zoe Zorn CC BY 4.0","mod":"SGD","modLink":"https://yeastgenome.org","linkVariable":""},{"value":"saccharomyces paradoxus","label":"Saccharomyces paradoxus ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. uvarum","label":"Saccharomyces uvarum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schistosoma","label":"Schistosoma","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"schizosaccharomyces japonicus","label":"Schizosaccharomyces japonicus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. pombe","label":"Schizosaccharomyces pombe","imageSrc":"pombe.png","imageAlt":"Pombe graphic by Zoe Zorn © Caltech","mod":"PomBase","modLink":"https://www.pombase.org/reference/PMID:","linkVariable":"pmId"},{"value":"schmidtea mediterranea","label":"Schmidtea mediterranea","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"senecio sp","label":"Senecio sp","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"simocephalus","label":"Simocephalus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"siraitia grosvenorii","label":"Siraitia grosvenorii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"solanum lycopersicum","label":"Solanum lycopersicum","imageSrc":"","imageAlt":"","mod":"Solgenomics Network","modLink":"https://solgenomics.net/organism/1/view/","linkVariable":""},{"value":"sorghum","label":"Sorghum","imageSrc":"","imageAlt":"","mod":"SorghumBase","modLink":"https://www.sorghumbase.org","linkVariable":""},{"value":"spiroplasma eriocheiris","label":"Spiroplasma eriocheiris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus aureus","label":"Staphylococcus aureus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"staphylococcus epidermidis","label":"Staphylococcus epidermidis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"steinernema carpocapsae","label":"Steinernema carpocapsae","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"https://wormbase.org","linkVariable":""},{"value":"steinernema hermaphroditum","label":"Steinernema hermaphroditum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stenotrophomonas geniculata","label":"Stenotrophomonas geniculata","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"stewartia floidana","label":"Stewartia floridana","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus gordonii ","label":"Streptococcus gordonii ","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"streptococcus mutans","label":"Streptococcus mutans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":" streptococcus pneumoniae","label":"Streptococcus pneumoniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"s. purpuratus","label":"Strongylocentrotus purpuratus","imageSrc":"","imageAlt":"","mod":"Echinobase","modLink":"https://www.echinobase.org","linkVariable":""},{"value":"strongyloides ratti","label":"Strongyloides ratti","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"sulfolobus","label":"Sulfolobus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"symphoricarpos albus","label":"Symphoricarpos albus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syncirsodes","label":"Syncirsodes","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"synechococcus elongatus","label":"Synechococcus elongatus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"syrphidae","label":"Syrphidae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tarantobelus jeffdanielsi","label":"Tarantobelus jeffdanielsi","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"taraxacum officinale","label":"Taraxacum officinale","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tatochila theodice","label":"Tatochila theodice","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetrahymena","label":"Tetrahymena","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tetramorium immigrans","label":"Tetramorium immigrans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tomato brown rugose fruit virus","label":"ToBRFV","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trachemys scripta","label":"Trachemys scripta","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tribolium castaneum","label":"Tribolium castaneum","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichoptera","label":"Trichoptera","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trichuris muris","label":"Trichuris muris","imageSrc":"","imageAlt":"","mod":"WormBase","modLink":"www.wormbase.org","linkVariable":""},{"value":"trifolium repens","label":"Trifolium repens","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"trypoxylus dichotomus","label":"Trypoxylus dichotomus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"tsuga canadensis","label":"Tsuga canadensis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"ulva expansa","label":"Ulva expansa","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"universal","label":"Universal","imageSrc":"","imageAlt":"","mod":null,"modLink":null,"linkVariable":null},{"value":"vargula hilgendorfii","label":"Vargula hilgendorfii","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"vespula vulgaris","label":"Vespula vulgaris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"virus","label":"Virus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"watasenia scintillans","label":"Watasenia scintillans","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"wolbachia pipientis","label":"Wolbachia pipientis","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"xenopus","label":"Xenopus","imageSrc":"xenopus.png","imageAlt":"Xenopus graphic by Zoe Zorn CC BY 4.0","mod":"XenBase","modLink":"https://xenbase.org","linkVariable":""},{"value":"xenorhabdus griffiniae","label":"Xenorhabdus griffiniae","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"yramea cytheris","label":"Yramea cytheris","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zaprionus indianus","label":"Zaprionus indianus","imageSrc":"","imageAlt":"","mod":"","modLink":"","linkVariable":""},{"value":"zea mays","label":"Zea mays","imageSrc":"","imageAlt":"","mod":"MaizeGDB","modLink":"https://www.maizegdb.org","linkVariable":""},{"value":"zebrafish","label":"Zebrafish","imageSrc":"zebrafish.png","imageAlt":"Zebrafish graphic by Zoe Zorn CC BY 4.0","mod":"ZFIN","modLink":"https://zfin.org","linkVariable":""}]}},"pageContext":{"id":"2906146d-83a2-41f5-846e-301946188b6d","citedBy":[],"parsedCsv":{"csvHeader":[],"csvData":[]}}}, "staticQueryHashes": ["2114697108"]}