<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.2 20190208//EN" "http://jats.nlm.nih.gov/archiving/1.2/JATS-archivearticle1.dtd">
<article article-type="brief-report" xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta>
      <journal-title-group>
        <journal-title>microPublication Biology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2578-9430</issn>
      <publisher>
        <publisher-name>Caltech Library</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.17912/micropub.biology.002386</article-id>
      <article-id pub-id-type="accession" assigning-authority="wormbase">WBPaper00070183</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>new finding</subject>
        </subj-group>
        <subj-group subj-group-type="subject">
          <subject>expression data</subject>
        </subj-group>
        <subj-group subj-group-type="species">
          <subject>c. elegans</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>
          Endogenous Expression of the Class I Phosphatidylinositol Transfer Protein PPIT-2 in 
          <italic>Caenorhabditis elegans</italic>
          <italic/>
        </article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name>
            <surname>Horne</surname>
            <given-names>Graycen</given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Validation" vocab-term-identifier="https://credit.niso.org/contributor-roles/validation">Validation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author" equal-contrib="yes">
          <name>
            <surname>Bai</surname>
            <given-names>Xiaofei </given-names>
          </name>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Conceptualization" vocab-term-identifier="https://credit.niso.org/contributor-roles/onceptualization">Conceptualization</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Data curation" vocab-term-identifier="https://credit.niso.org/contributor-roles/data-curation">Data curation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Formal analysis" vocab-term-identifier="https://credit.niso.org/contributor-roles/formal-analysis">Formal analysis</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Investigation" vocab-term-identifier="https://credit.niso.org/contributor-roles/investigation">Investigation</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Methodology" vocab-term-identifier="https://credit.niso.org/contributor-roles/methodology">Methodology</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - original draft" vocab-term-identifier="https://credit.niso.org/contributor-roles/writing-original-draft">Writing - original draft</role>
          <role vocab="credit" vocab-identifier="https://credit.niso.org/" vocab-term="Writing - review &amp; editing" vocab-term-identifier="https://credit.niso.org/contributor-roles/Writing-review-editing">Writing - review &amp; editing</role>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="aff" rid="aff2">2</xref>
          <xref ref-type="corresp" rid="cor1">§</xref>
        </contrib>
        <aff id="aff1">
          <label>1</label>
          Department of Biology, University of Florida, Gainesville, FL, United States
        </aff>
        <aff id="aff2">
          <label>2</label>
          Genetics Institute, University of Florida, Gainesville, Florida, United States
        </aff>
      </contrib-group>
      <contrib-group>
        <contrib contrib-type="reviewer">
          <anonymous/>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor1">
          <label>§</label>
          Correspondence to: Xiaofei  Bai (
          <email>baixiaofei@ufl.edu</email>
          )
        </corresp>
        <fn fn-type="coi-statement">
          <p>The authors declare that there are no conflicts of interest present.</p>
        </fn>
      </author-notes>
      <pub-date date-type="pub" publication-format="electronic">
        <day>24</day>
        <month>9</month>
        <year>2026</year>
      </pub-date>
      <pub-date date-type="collection" publication-format="electronic">
        <year>2026</year>
      </pub-date>
      <volume>2026</volume>
      <elocation-id>10.17912/micropub.biology.002386</elocation-id>
      <history>
        <date date-type="received">
          <day>29</day>
          <month>8</month>
          <year>2026</year>
        </date>
        <date date-type="rev-recd">
          <day>15</day>
          <month>9</month>
          <year>2026</year>
        </date>
        <date date-type="accepted">
          <day>22</day>
          <month>9</month>
          <year>2026</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Copyright: © 2026 by the authors</copyright-statement>
        <copyright-year>2026</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          Phosphatidylinositol transfer proteins (PITPs) transfer phosphatidylinositol (PI) between the ER and target membranes to regulate phosphoinositide metabolism. However, the expression patterns of class I PITPs in 
          <italic>C. elegans</italic>
           remain largely uncharacterized. Here, we generated an endogenous GFP knock-in reporter for PPIT-2 (formerly Y71G12B.17), a conserved homolog of human PITPNA and PITPNB. GFP::PPIT-2 was prominently expressed in the excretory system and canals, with additional expression in the hypodermis, sperm, developing vulva, and germline-adjacent pseudocoelom. PPIT-2 expression notably overlaps with fatty acid synthase FASN-1, establishing candidate tissues to investigate its roles in PI transfer, membrane trafficking, and lipid homeostasis.
        </p>
      </abstract>
      <funding-group>
        <funding-statement>This work was supported by the National Institute of General Medical Sciences/National Institutes of Health under Awards Numbers R00GM145224 and R35GM162564-01 to X.F.B. and G.H., as well as startup funds from the University of Florida to the Bai laboratory.</funding-statement>
      </funding-group>
    </article-meta>
  </front>
  <body>
    <fig position="anchor" id="f1">
      <label>
        Figure 1. Endogenous expression of GFP::PPIT-2 in multiple 
        <italic>C. elegans</italic>
         tissues
      </label>
      <caption>
        <p>
          (A) Schematic representation of the endogenous 
          <italic>GFP::PPIT-2</italic>
           reporter locus with an N-terminal GFP tag immediately upstream of the 
          <italic>PPIT-2 </italic>
          coding sequence.  (B–B″) Representative images showing GFP::PPIT-2 (green in B'') in the anterior excretory region near the pharynx, co-localization with 
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
          ::RFP (magenta in B''). Monochromatic images show GFP::PPIT-2 (B) and 
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
          ::RFP (B'). Yellow arrows highlight representative areas of the spatial overlap. (C–C″) Co-expression of GFP::PPIT-2 (C) and 
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
          ::RFP (C') in hypodermal cells. with the merged image shown in (C''). Yellow arrows indicate hypodermal nuclei. (D) GFP::PPIT-2 signal in the pseudocoelomic region (yellow arrow) and residual-body-associated structures (red arrow). (E) GFP::PPIT-2 expression in sperm; the yellow arrow points to a representative GFP-positive sperm cell. (F) GFP::PPIT-2 expression in the developing vulval (yellow arrow). Scale bars are indicated in each panel.  
        </p>
      </caption>
    </fig>
    <graphic xlink:href="25789430-2026-micropub.biology.002386"/>
    <sec>
      <title>Description</title>
      <p>Phosphatidylinositol transfer proteins (PITPs) are conserved lipid-binding proteins that support phosphatidylinositol (PI) metabolism and phosphoinositide-dependent cellular processes. PI is synthesized primarily in the endoplasmic reticulum (ER), whereas its phosphorylated derivatives are enriched at distinct cellular membranes, such as PI4P at the Golgi complex and PI(4,5)P2 at the plasma membrane (Ashlin, Blunsom, &amp; Cockcroft, 2021). Class I PITPs, including mammalian PITPNA and PITPNB, specifically bind PI and phosphatidylcholine (PC) to facilitate PI phosphoinositide synthesis across distinct membrane compartments (Ashlin, Blunsom, &amp; Cockcroft, 2021; Grabon, Khan, &amp; Bankaitis, 2015). Consequently,  PITPs play essential roles in membrane trafficking, secretion, and intracellular signaling (Ashlin, Blunsom, &amp; Cockcroft, 2021). In mammals, PITPNA performs critical physiological functions in secretory tissues. For example, loss of PITPNA in pancreatic beta cells disrupts PI4P production, leading to hyperglycemia and reduced glucose-stimulated insulin secretion, highlighting its potential as a therapeutic target for type 2 diabetes (Yeh et al., 2023).</p>
      <p>
        The 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
         genome encodes two predicted class I PITPs, 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00021854">Y54F10AR.1</ext-link>
         and PPIT-2, as well as the class II PITP 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00010813">PITP-1</ext-link>
         (Iwata et al., 2011). 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00010813">PITP-1</ext-link>
         has been characterized in sensory neurons, where it regulates phosphoinositide-dependent neurotransmission and behavioral plasticity (Iwata et al., 2011). More recently, reduction of 
        <italic>
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00010813">pitp-1</ext-link>
        </italic>
         gene expression was also shown to extend lifespan through insulin/IGF-1 and TOR signaling pathways (Lin et al., 2026). In contrast, relatively little is known about the anatomical distribution or physiological functions of class I PITPs in 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
        .
      </p>
      <p>To determine the endogenous expression pattern of PITPs, we generated an N-terminal GFP knock-in reporter at the endogenous locus of PPIT-2 using CRISPR/Cas9 genome editing (Figure A). GFP::PPIT-2 was detected in the excretory cell body and canals, the hypodermis, mature sperm, sperm-associated residual bodies, and the developing vulva, all of which are known for active lipid metabolism. Prominent expression was observed in the anterior excretory system (Figure B-B'), a structure functionally analogous to the mammalian renal system that serves as a hub for fluid balance and metabolic waste elimination. This system relies heavily on phospholipids, such as PI, and their metabolic derivatives to maintain its unique architecture and support intracellular transport pathways (Sundaram &amp; Buechner, 2016).</p>
      <p>
        Given the roles of class I PITPs in lipid transport and phosphoinositide signaling, we asked whether PPIT-2 is expressed in tissues that also express the lipogenic enzyme 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
        . We therefore examined GFP::PPIT-2 in animals that also express 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
        ::RFP, an endogenous reporter of the 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
         fatty acid synthase required for 
        <italic>de novo</italic>
         fatty acid synthesis (Starich, Bai, &amp; Greenstein, 2020; Wang et al., 2026). Endogenous GFP-tagged 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
         is broadly expressed in somatic tissues, with prominent expression in the hypodermis, excretory duct, and developing vulva, and serves as a key marker for lipid-enriched cellular compartments (Starich, Bai, &amp; Greenstein, 2020). GFP::PPIT-2 showed marked co-localization with 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
        ::RFP within several regions surrounding the pharynx and the excretory cell body (Figure B-B''). Strong GFP::PPIT-2 signal was also observed along the lateral body wall in areas corresponding to the hypodermis (Figure C-C''), where it co-localized with 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
        ::RFP. These observations, GFP::PPIT-2 and 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
        ::RFP signals, were both detected in the examined excretory and hypodermal regions, indicating tissue-level overlap in these regions.
      </p>
      <p>Beyond the excretory system, GFP::PPIT-2 was detected in several reproductive and reproduction-associated tissues (Figure D-F). Fluorescent signals were present in the pseudocoelomic region adjacent to the germline and within structures associated with the residual body (Figure D) as well as in mature sperm (Figure E). Because the pseudocoelomic cavity functions as a key site for lipid transport and exchange between somatic sheath cells and the germline (Perez &amp; Lehner, 2019), this localization suggests potential roles for PPIT-2 in reproductive lipid transport.</p>
      <p>
        Finally, GFP::PPIT-2 fluorescent signal was observed in the developing vulva (Figure F), another tissue where 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
         is known to function (Starich, Bai, &amp; Greenstein, 2020; Wang et al., 2026). Vulval morphogenesis requires coordinated cell-cell signaling, extensive membrane remodeling, and active membrane trafficking (Sternberg, 2005). The presence of PPIT-2 in this tissue suggests that this class I PITP might participate in membrane dynamics during organogenesis and 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
         vulvar morphogenesis.
      </p>
      <p>
        In summary, our endogenous tag reveals the tissue-specific distribution of the previously uncharacterized class I PITP PPIT-2 in 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
          .
        </italic>
         Its
        <italic/>
        expression in the excretory system, hypodermis, reproductive structures, and developing vulva—combined with its spatial overlap with 
        <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">FASN-1</ext-link>
        —provides an anatomical framework for future investigations into its functional roles in phosphoinositide metabolism, membrane trafficking, and organismal lipid homeostasis.
      </p>
    </sec>
    <sec>
      <title>Methods</title>
      <p>
        <bold>Microscopy</bold>
      </p>
      <p>All fluorescence imaging was performed using a spinning-disk confocal system equipped with a Nikon 60× 1.2 NA water-immersion objective, a Hamamatsu C15440 ORCA-Fusion BT Digital camera, and a Yokogawa CSU-X1 confocal scanner unit. Imaging acquisition was controlled by Nikon's NIS-Element software (Version 6.10). Image processing and channel merging were conducted using the ImageJ/FIJI Bio-Formats plugin (Fiji/ImageJ: ImageJ version 1.54f; Bio-Formats plugin: version 7.0.0) (National Institutes of Health) (Linkert et al., 2010; Schindelin et al., 2012).</p>
      <p>
        <bold>
          Mounting 
          <italic>
            <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
          </italic>
           for imaging
        </bold>
      </p>
      <p>Animals were mounted on 7% agarose pads in M9 buffer containing 7.5 mM levamisole and covered with a coverslip. The synchronized mid or late L4 animals were used for imaging in panels B–C'', and young adult hermaphrodites were imaged in panels D-F.</p>
      <p>
        <bold>Generation of CRISPR knock-in strains</bold>
      </p>
      <p>
        CRISPR/Cas9 editing was performed using the Bristol 
        <ext-link ext-link-type="wormbase" xlink:href="WBStrain00000001">N2</ext-link>
         strain as the wild type. Synthetic crRNAs and tracrRNA were purchased from Horizon Discovery. Repair templates and single-stranded DNA oligos were synthesized by Integrated DNA Technologies (IDT). Approximately 20-30 young adult hermaphrodites were injected with the CRISPR/Cas9 injection mix. The N-terminal tag was amplified from the plasmid pDD282, which contains 
        <italic>
          <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
        </italic>
         codon-optimized eGFP. We co-injected the 
        <italic>
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00001072">dpy-10</ext-link>
          (
          <ext-link ext-link-type="wormbase" xlink:href="WBVar00054207">cn64</ext-link>
          )
        </italic>
         roller marker with the GFP::PPIT-2 injection reagent (Arribere et al., 2014). The sequences for the 
        <italic>
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00001072">dpy-10</ext-link>
          (
          <ext-link ext-link-type="wormbase" xlink:href="WBVar00054207">cn64</ext-link>
          )
        </italic>
         crRNA and single-stranded repair template (ssODN) have been added to the Reagents section/table. F1 roller progeny of injected animals were initially selected based on visible GFP expression and subsequently screened by single-worm PCR across the insertion boundaries using the primers: Forward 5' ccccctttgaaaactcacattt 3' and Reverse 5' gggttttaggccatctgtgga 3'. The amplification sequence is listed below:
      </p>
      <p>
        ccccctttgaaaactcacatttataaattttgatttttggaaatgaattaattaatttctaatttgaactttcagctttattttgaaattttttttttaataatcgttaaaggtcaaattacgtataacagttggaattggtcaaatttttcaaaacaacttcattacttcgaaaaaaac
        <bold>ATG</bold>
        agtaaaggagaagaattgttcactggagttgtcccaatcctcgtcgagctcgacggagacgtcaacggacacaagttctccgtctccggagagggagagggagacgccacctacggaaagctcaccctcaagttcatctgcaccaccggaaagctcccagtcccatggccaaccctcgtcaccaccttctgctacggagtccaatgcttctcccgttacccagaccacatgaagcgtcacgacttcttcaagtccgccatgccagagggatacgtccaagagcgtaccatcttcttcaaggtaagtttaaacatatatatactaactactgattatttaaattttcaggacgacggaaactacaagacccgtgccgaggtcaagttcgagggagacaccctcgtcaaccgtatcgagctcaaggtaagtttaaacagttcggtactaactaaccatacatatttaaattttcagggaatcgacttcaaggaggacggaaacatcctcggacacaagctcgagtacaactacaactcccacaacgtctacatcatggccgacaagcaaaagaacggaatcaaggtcaacttcaaggtaagtttaaacatgattttactaactaactaatctgatttaaattttcagatccgtcacaacatcgaggacggatccgtccaactcgccgaccactaccaacaaaacaccccaatcggagacggaccagtcctcctcccagacaaccactacctctccacccaatccgccctctccaaggacccaaacgagaagcgtgaccacatggtcctcctcgagttcgtcaccgccgccggaatcacccacggaatggacgagctctacaagggagcatcgggagcctcaggagcatcgATTGTAAAGgtgagttattttttgatattggaagatggccgaagaattctatggtggcctaggaatccacagatggcctaaaaccc
      </p>
      <p>Candidate insertions were validated by Sanger sequencing of both the 5′ and 3′ genomic junctions. All GFP::PPIT-2 lines used for imaging were established as homozygous knock-in stocks before imaging.</p>
      <p>GFP::PPIT-2 CRISPR information:</p>
      <p>Guide RNA: 5' CGAAAAAAACATGATTGTAA”</p>
      <p>Repair template primer F1: 5' tttcaaaacaacttcattacttcgaaaaaaacATG agtaaaggagaagaattgttc 3'</p>
      <p>Repair template primer R1: 5' tcttccaatatcaaaaaataactcacCTTTACAAT cgatgctcctgaggctcccgatgctcc CTTGTAGAGCTCGTCCATTC 3'</p>
      <p>Genotype Primer F1: 5' ccccctttgaaaactcacattt 3'</p>
      <p>Genotype Primer R1: 5' gggttttaggccatctgtgga 3' </p>
      <p>
        <italic>
          <ext-link ext-link-type="wormbase" xlink:href="WBGene00001072">dpy-10</ext-link>
          (
          <ext-link ext-link-type="wormbase" xlink:href="WBVar00054207">cn64</ext-link>
          )
        </italic>
         CRISPR information:
      </p>
      <p>Guide RNA: 5' GCTACCATAGGCACCACGAG”</p>
      <p>Repair template: 5' CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCATGCGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT 3'</p>
      <p>
        <bold>
          <italic>
            <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6239">C. elegans</ext-link>
          </italic>
           strains used in this study:
        </bold>
      </p>
      <table-wrap>
        <table>
          <tbody>
            <tr>
              <td>
                <p>
                  <bold>Strain Name</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Genotype</bold>
                </p>
              </td>
              <td>
                <p>
                  <bold>Source</bold>
                </p>
              </td>
            </tr>
            <tr>
              <td>
                <p>
                  <ext-link ext-link-type="wormbase" xlink:href="WBStrain00000001">N2</ext-link>
                </p>
              </td>
              <td>
                <p>Bristol wild-type</p>
              </td>
              <td>
                <p>CGC</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>XFB7</p>
              </td>
              <td>
                <p>
                  <italic>
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">fasn-1</ext-link>
                    (xmb13[
                    <ext-link ext-link-type="wormbase" xlink:href="WBGene00009342">fasn-1</ext-link>
                    ::rfp]) I
                  </italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
            <tr>
              <td>
                <p>XFB143</p>
              </td>
              <td>
                <p>
                  <italic>PPIT-2(xmb11[GFP::PPIT-2]) I</italic>
                </p>
              </td>
              <td>
                <p>This study</p>
              </td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>
        <bold>Acknowledgments:</bold>
      </p>
      <p>
        We thank the 
        <ext-link ext-link-type="uri" xlink:href="https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&amp;id=6237">Caenorhabditis</ext-link>
         Genetics Center (CGC), which is funded by the National Institutes of Health Office of Research Infrastructure Programs (P40OD010440), for providing strains for this study. We also thank members of the UF Worm community for insightful feedback and discussion.
      </p>
      <p>
        <bold>Funding:</bold>
      </p>
      <p>This work was supported by the National Institute of General Medical Sciences/National Institutes of Health under Awards Numbers R00GM145224 and R35GM162564-01 to X.F.B. and G.H., as well as startup funds from the University of Florida to the Bai laboratory.</p>
    </sec>
  </body>
  <back>
    <ack>
      <sec>
        <p>We thank the Caenorhabditis Genetics Center (CGC), which is funded by the National Institutes of Health Office of Research Infrastructure Programs (P40OD010440), for providing strains for this study. We also thank members of the UF Worm community for insightful feedback and discussion.</p>
      </sec>
    </ack>
    <ref-list>
      <ref id="R1">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Arribere</surname>
              <given-names>JA</given-names>
            </name>
            <name>
              <surname>Bell</surname>
              <given-names>RT</given-names>
            </name>
            <name>
              <surname>Fu</surname>
              <given-names>BX</given-names>
            </name>
            <name>
              <surname>Artiles</surname>
              <given-names>KL</given-names>
            </name>
            <name>
              <surname>Hartman</surname>
              <given-names>PS</given-names>
            </name>
            <name>
              <surname>Fire</surname>
              <given-names>AZ</given-names>
            </name>
          </person-group>
          <year>2014</year>
          <month>8</month>
          <day>26</day>
          <article-title>Efficient marker-free recovery of custom genetic modifications with CRISPR/Cas9 in Caenorhabditis elegans.</article-title>
          <source>Genetics</source>
          <volume>198</volume>
          <issue>3</issue>
          <issn>0016-6731</issn>
          <fpage>837</fpage>
          <lpage>846</lpage>
          <pub-id pub-id-type="doi">10.1534/genetics.114.169730</pub-id>
          <pub-id pub-id-type="pmid">25161212</pub-id>
        </element-citation>
      </ref>
      <ref id="R2">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ashlin</surname>
              <given-names>Tim G.</given-names>
            </name>
            <name>
              <surname>Blunsom</surname>
              <given-names>Nicholas J.</given-names>
            </name>
            <name>
              <surname>Cockcroft</surname>
              <given-names>Shamshad</given-names>
            </name>
          </person-group>
          <year>2021</year>
          <month>9</month>
          <day>1</day>
          <article-title>Courier service for phosphatidylinositol: PITPs deliver on demand</article-title>
          <source>Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids</source>
          <volume>1866</volume>
          <issue>9</issue>
          <issn>1388-1981</issn>
          <fpage>158985</fpage>
          <lpage>158985</lpage>
          <pub-id pub-id-type="doi">10.1016/j.bbalip.2021.158985</pub-id>
        </element-citation>
      </ref>
      <ref id="R3">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Grabon</surname>
              <given-names>Aby</given-names>
            </name>
            <name>
              <surname>Khan</surname>
              <given-names>Danish</given-names>
            </name>
            <name>
              <surname>Bankaitis</surname>
              <given-names>Vytas A.</given-names>
            </name>
          </person-group>
          <year>2015</year>
          <month>6</month>
          <day>1</day>
          <article-title>Phosphatidylinositol transfer proteins and instructive regulation of lipid kinase biology</article-title>
          <source>Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids</source>
          <volume>1851</volume>
          <issue>6</issue>
          <issn>1388-1981</issn>
          <fpage>724</fpage>
          <lpage>735</lpage>
          <pub-id pub-id-type="doi">10.1016/j.bbalip.2014.12.011</pub-id>
        </element-citation>
      </ref>
      <ref id="R4">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Iwata</surname>
              <given-names>Ryo</given-names>
            </name>
            <name>
              <surname>Oda</surname>
              <given-names>Shigekazu</given-names>
            </name>
            <name>
              <surname>Kunitomo</surname>
              <given-names>Hirofumi</given-names>
            </name>
            <name>
              <surname>Iino</surname>
              <given-names>Yuichi</given-names>
            </name>
          </person-group>
          <year>2011</year>
          <month>4</month>
          <day>18</day>
          <article-title>
            Roles for class IIA phosphatidylinositol transfer protein in neurotransmission and behavioral plasticity at the sensory neuron synapses of
                    
            <italic>Caenorhabditis elegans</italic>
          </article-title>
          <source>Proceedings of the National Academy of Sciences</source>
          <volume>108</volume>
          <issue>18</issue>
          <issn>0027-8424</issn>
          <fpage>7589</fpage>
          <lpage>7594</lpage>
          <pub-id pub-id-type="doi">10.1073/pnas.1016232108</pub-id>
        </element-citation>
      </ref>
      <ref id="R5">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lin</surname>
              <given-names>Yen-Hung</given-names>
            </name>
            <name>
              <surname>Liao</surname>
              <given-names>Yun-Hsun</given-names>
            </name>
            <name>
              <surname>Liao</surname>
              <given-names>Sin-Bo</given-names>
            </name>
            <name>
              <surname>Lin</surname>
              <given-names>Tzu-Yu</given-names>
            </name>
            <name>
              <surname>Shanmugam</surname>
              <given-names>Muniesh Muthaiyan</given-names>
            </name>
            <name>
              <surname>Hsu</surname>
              <given-names>Pei-Jia</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>Chang-Shi</given-names>
            </name>
            <name>
              <surname>Ching</surname>
              <given-names>Tsiu-Ting</given-names>
            </name>
            <name>
              <surname>Wagner</surname>
              <given-names>Oliver Ingvar</given-names>
            </name>
            <name>
              <surname>Yuh</surname>
              <given-names>Chiou-Hwa</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Horng-Dar</given-names>
            </name>
          </person-group>
          <year>2026</year>
          <month>4</month>
          <day>27</day>
          <article-title>Phosphatidylinositol transfer protein-1 integrates insulin/IGF-1 and TOR signaling to negatively regulate lifespan and healthspan in Caenorhabditis elegans</article-title>
          <source>Journal of Biomedical Science</source>
          <volume>33</volume>
          <issue>1</issue>
          <issn>1423-0127</issn>
          <pub-id pub-id-type="doi">10.1186/s12929-026-01246-x</pub-id>
        </element-citation>
      </ref>
      <ref id="R6">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Linkert</surname>
              <given-names>Melissa</given-names>
            </name>
            <name>
              <surname>Rueden</surname>
              <given-names>Curtis T.</given-names>
            </name>
            <name>
              <surname>Allan</surname>
              <given-names>Chris</given-names>
            </name>
            <name>
              <surname>Burel</surname>
              <given-names>Jean-Marie</given-names>
            </name>
            <name>
              <surname>Moore</surname>
              <given-names>Will</given-names>
            </name>
            <name>
              <surname>Patterson</surname>
              <given-names>Andrew</given-names>
            </name>
            <name>
              <surname>Loranger</surname>
              <given-names>Brian</given-names>
            </name>
            <name>
              <surname>Moore</surname>
              <given-names>Josh</given-names>
            </name>
            <name>
              <surname>Neves</surname>
              <given-names>Carlos</given-names>
            </name>
            <name>
              <surname>MacDonald</surname>
              <given-names>Donald</given-names>
            </name>
            <name>
              <surname>Tarkowska</surname>
              <given-names>Aleksandra</given-names>
            </name>
            <name>
              <surname>Sticco</surname>
              <given-names>Caitlin</given-names>
            </name>
            <name>
              <surname>Hill</surname>
              <given-names>Emma</given-names>
            </name>
            <name>
              <surname>Rossner</surname>
              <given-names>Mike</given-names>
            </name>
            <name>
              <surname>Eliceiri</surname>
              <given-names>Kevin W.</given-names>
            </name>
            <name>
              <surname>Swedlow</surname>
              <given-names>Jason R.</given-names>
            </name>
          </person-group>
          <year>2010</year>
          <month>5</month>
          <day>31</day>
          <article-title>Metadata matters: access to image data in the real world</article-title>
          <source>Journal of Cell Biology</source>
          <volume>189</volume>
          <issue>5</issue>
          <issn>1540-8140</issn>
          <fpage>777</fpage>
          <lpage>782</lpage>
          <pub-id pub-id-type="doi">10.1083/jcb.201004104</pub-id>
        </element-citation>
      </ref>
      <ref id="R7">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Perez</surname>
              <given-names>Marcos Francisco</given-names>
            </name>
            <name>
              <surname>Lehner</surname>
              <given-names>Ben</given-names>
            </name>
          </person-group>
          <year>2019</year>
          <month>8</month>
          <day>21</day>
          <article-title>Vitellogenins - Yolk Gene Function and Regulation in Caenorhabditis elegans</article-title>
          <source>Frontiers in Physiology</source>
          <volume>10</volume>
          <issn>1664-042X</issn>
          <pub-id pub-id-type="doi">10.3389/fphys.2019.01067</pub-id>
        </element-citation>
      </ref>
      <ref id="R8">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Schindelin</surname>
              <given-names>Johannes</given-names>
            </name>
            <name>
              <surname>Arganda-Carreras</surname>
              <given-names>Ignacio</given-names>
            </name>
            <name>
              <surname>Frise</surname>
              <given-names>Erwin</given-names>
            </name>
            <name>
              <surname>Kaynig</surname>
              <given-names>Verena</given-names>
            </name>
            <name>
              <surname>Longair</surname>
              <given-names>Mark</given-names>
            </name>
            <name>
              <surname>Pietzsch</surname>
              <given-names>Tobias</given-names>
            </name>
            <name>
              <surname>Preibisch</surname>
              <given-names>Stephan</given-names>
            </name>
            <name>
              <surname>Rueden</surname>
              <given-names>Curtis</given-names>
            </name>
            <name>
              <surname>Saalfeld</surname>
              <given-names>Stephan</given-names>
            </name>
            <name>
              <surname>Schmid</surname>
              <given-names>Benjamin</given-names>
            </name>
            <name>
              <surname>Tinevez</surname>
              <given-names>Jean-Yves</given-names>
            </name>
            <name>
              <surname>White</surname>
              <given-names>Daniel James</given-names>
            </name>
            <name>
              <surname>Hartenstein</surname>
              <given-names>Volker</given-names>
            </name>
            <name>
              <surname>Eliceiri</surname>
              <given-names>Kevin</given-names>
            </name>
            <name>
              <surname>Tomancak</surname>
              <given-names>Pavel</given-names>
            </name>
            <name>
              <surname>Cardona</surname>
              <given-names>Albert</given-names>
            </name>
          </person-group>
          <year>2012</year>
          <month>6</month>
          <day>28</day>
          <article-title>Fiji: an open-source platform for biological-image analysis</article-title>
          <source>Nature Methods</source>
          <volume>9</volume>
          <issue>7</issue>
          <issn>1548-7091</issn>
          <fpage>676</fpage>
          <lpage>682</lpage>
          <pub-id pub-id-type="doi">10.1038/nmeth.2019</pub-id>
        </element-citation>
      </ref>
      <ref id="R9">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Starich</surname>
              <given-names>Todd A</given-names>
            </name>
            <name>
              <surname>Bai</surname>
              <given-names>Xiaofei</given-names>
            </name>
            <name>
              <surname>Greenstein</surname>
              <given-names>David</given-names>
            </name>
          </person-group>
          <year>2020</year>
          <month>7</month>
          <day>31</day>
          <article-title>Gap junctions deliver malonyl-CoA from soma to germline to support embryogenesis in Caenorhabditis elegans</article-title>
          <source>eLife</source>
          <volume>9</volume>
          <issn>2050-084X</issn>
          <pub-id pub-id-type="doi">10.7554/elife.58619</pub-id>
        </element-citation>
      </ref>
      <ref id="R10">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sternberg</surname>
              <given-names>Paul W.</given-names>
            </name>
          </person-group>
          <year>2005</year>
          <article-title>Vulval development</article-title>
          <source>WormBook</source>
          <issn>1551-8507</issn>
          <pub-id pub-id-type="doi">10.1895/wormbook.1.6.1</pub-id>
        </element-citation>
      </ref>
      <ref id="R11">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sundaram</surname>
              <given-names>Meera V</given-names>
            </name>
            <name>
              <surname>Buechner</surname>
              <given-names>Matthew</given-names>
            </name>
          </person-group>
          <year>2016</year>
          <month>5</month>
          <day>1</day>
          <article-title>
            The 
            <italic>Caenorhabditis elegans</italic>
             Excretory System: A Model for Tubulogenesis, Cell Fate Specification, and Plasticity
          </article-title>
          <source>Genetics</source>
          <volume>203</volume>
          <issue>1</issue>
          <issn>1943-2631</issn>
          <fpage>35</fpage>
          <lpage>63</lpage>
          <pub-id pub-id-type="doi">10.1534/genetics.116.189357</pub-id>
        </element-citation>
      </ref>
      <ref id="R12">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wang</surname>
              <given-names>Yooseong</given-names>
            </name>
            <name>
              <surname>Rincon Paz</surname>
              <given-names>Milagros</given-names>
            </name>
            <name>
              <surname>Fan</surname>
              <given-names>Xiao</given-names>
            </name>
            <name>
              <surname>Smith</surname>
              <given-names>Harold E</given-names>
            </name>
            <name>
              <surname>Roure</surname>
              <given-names>Ricardo</given-names>
            </name>
            <name>
              <surname>Patil</surname>
              <given-names>Anushka</given-names>
            </name>
            <name>
              <surname>Shao</surname>
              <given-names>Crystal</given-names>
            </name>
            <name>
              <surname>Shao</surname>
              <given-names>Christy</given-names>
            </name>
            <name>
              <surname>Garcia</surname>
              <given-names>Caitlyn</given-names>
            </name>
            <name>
              <surname>Brill</surname>
              <given-names>Ellie N</given-names>
            </name>
            <name>
              <surname>Zheng</surname>
              <given-names>Ziqi (Kyra)</given-names>
            </name>
            <name>
              <surname>Monsalve</surname>
              <given-names>Sophia</given-names>
            </name>
            <name>
              <surname>Bruner</surname>
              <given-names>Samantha H</given-names>
            </name>
            <name>
              <surname>Itraish</surname>
              <given-names>Jena</given-names>
            </name>
            <name>
              <surname>Morton</surname>
              <given-names>Sophia R</given-names>
            </name>
            <name>
              <surname>Bai</surname>
              <given-names>Xiaofei</given-names>
            </name>
          </person-group>
          <year>2026</year>
          <month>7</month>
          <day>4</day>
          <article-title>
            Loss of
                    
            <italic>ptr-6</italic>
            
                    restores eggshell integrity and embryonic viability in
                    
            <italic>Caenorhabditis elegans</italic>
            
                    fatty acid synthase mutants
          </article-title>
          <source>G3: Genes, Genomes, Genetics</source>
          <issn>2160-1836</issn>
          <pub-id pub-id-type="doi">10.1093/g3journal/jkag182</pub-id>
        </element-citation>
      </ref>
      <ref id="R13">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Yeh</surname>
              <given-names>Yu-Te</given-names>
            </name>
            <name>
              <surname>Sona</surname>
              <given-names>Chandan</given-names>
            </name>
            <name>
              <surname>Yan</surname>
              <given-names>Xin</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>Yunxiao</given-names>
            </name>
            <name>
              <surname>Pathak</surname>
              <given-names>Adrija</given-names>
            </name>
            <name>
              <surname>McDermott</surname>
              <given-names>Mark I.</given-names>
            </name>
            <name>
              <surname>Xie</surname>
              <given-names>Zhigang</given-names>
            </name>
            <name>
              <surname>Liu</surname>
              <given-names>Liangwen</given-names>
            </name>
            <name>
              <surname>Arunagiri</surname>
              <given-names>Anoop</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>Yuting</given-names>
            </name>
            <name>
              <surname>Cazenave-Gassiot</surname>
              <given-names>Amaury</given-names>
            </name>
            <name>
              <surname>Ghosh</surname>
              <given-names>Adhideb</given-names>
            </name>
            <name>
              <surname>von Meyenn</surname>
              <given-names>Ferdinand</given-names>
            </name>
            <name>
              <surname>Kumarasamy</surname>
              <given-names>Sivarajan</given-names>
            </name>
            <name>
              <surname>Najjar</surname>
              <given-names>Sonia M.</given-names>
            </name>
            <name>
              <surname>Jia</surname>
              <given-names>Shiqi</given-names>
            </name>
            <name>
              <surname>Wenk</surname>
              <given-names>Markus R.</given-names>
            </name>
            <name>
              <surname>Traynor-Kaplan</surname>
              <given-names>Alexis</given-names>
            </name>
            <name>
              <surname>Arvan</surname>
              <given-names>Peter</given-names>
            </name>
            <name>
              <surname>Barg</surname>
              <given-names>Sebastian</given-names>
            </name>
            <name>
              <surname>Bankaitis</surname>
              <given-names>Vytas A.</given-names>
            </name>
            <name>
              <surname>Poy</surname>
              <given-names>Matthew N.</given-names>
            </name>
          </person-group>
          <year>2023</year>
          <month>7</month>
          <day>17</day>
          <article-title>Restoration of PITPNA in Type 2 diabetic human islets reverses pancreatic beta-cell dysfunction</article-title>
          <source>Nature Communications</source>
          <volume>14</volume>
          <issue>1</issue>
          <issn>2041-1723</issn>
          <pub-id pub-id-type="doi">10.1038/s41467-023-39978-1</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>
