Description
Ubiquitin (Ub) is a highly conserved 76-amino-acid protein, and ubiquitination is an essential post-translational modification that attaches a single ubiquitin moiety or polyubiquitin chains to target substrates (Kipreos 2005; Ross, 2011; Cecile, 2001). Ubiquitination is catalyzed through a sequential three-enzyme cascade comprising E1 activating, E2 conjugating, and E3 ligating enzymes (Cecile, 2001). E3 ubiquitin ligases confer substrate specificity and are classified into four major families: HECT-domain, monomeric RING, multi-subunit RING finger complexes, and U-box proteins (Ross, 2011; Cecile, 2001). As the terminal step in the cascade, E3 ligases target specific proteins for selective degradation by the 26S proteasome, thereby coordinating cell cycle progression, immune and inflammatory signaling, and antigen presentation (Ross, 2011). Consequently, aberrant ubiquitin-dependent proteolysis drives tumorigenesis and neurodegeneration by disrupting DNA repair, cellular differentiation, and programmed cell death (PCD) (Ross, 2011; Cecile, 2001). In humans, pathogenic variants in E3 ligases, including the HECT-domain HUWE1, underlie neurodevelopmental conditions, such as Turner-type X-linked syndromic intellectual disability (MRXST), which are associated with craniofacial dysmorphisms, microcephaly or macrocephaly, and variable delays in speech and gross motor milestones (Dai, 2026; De Falco, 2025).
Among the cellular pathways governed by ubiquitin-dependent proteolysis, the surveillance of genomic integrity and DNA damage-induced apoptosis represent two of the most critical regulatory mechanisms. In higher eukaryotes, this checkpoint is largely executed by the p53 tumor suppressor (encoded by the
TP53
gene), whose stability and function are tightly regulated by ubiquitin ligases. Post-translational modifications, including ubiquitination, phosphorylation, and acetylation, govern p53 stability, subcellular localization, and transcriptional activation (Aubrey, 2016). p53 is activated in response to oncogenic and genotoxic stress, initiating PCD in response to DNA damage induced by ionizing radiation (Ross, 2011; Aubrey, 2016). Under basal conditions, p53 levels are kept low by the RING E3 ligase MDM2, which ubiquitinates p53 to direct its proteasomal degradation via an autoregulatory negative feedback loop; upon genotoxic stress, this interaction is rapidly uncoupled, allowing p53 stabilization and checkpoint activation (Ross, 2011; Aubrey, 2016).
This critical link between E3 ubiquitin ligases and p53-dependent apoptosis is evolutionarily conserved. In
Caenorhabditis elegans
,
cep-1
is the homolog of
TP53
and is required for DNA-damage-induced germline apoptosis by activating pro-apoptotic genes to induce apoptosis (Ross 2011; Baruah, 2014). Previous studies established that
eel-1
acts in a parallel pathway to
cep-1
to coordinate this checkpoint response (Ross, 2011; Baruah, 2016). The
C. elegans
eel-1
gene encodes a HECT-type E3 ubiquitin ligase orthologous to mammalian HUWE1 (HECT, UBA, and WWE domain-containing protein 1) (Ross, 2011).
EEL-1
positively regulates apoptotic kinetics and sensitivity to genotoxic stress (Ross, 2011). Loss of
eel-1
function leads to hypersensitivity to genotoxic stress and neuronal abnormalities, including excessive dendrite branching and aberrant synaptic architecture (Ross, 2011; Opperman, 2017; Xie, 2023).
C. elegans
provides a powerful genetic model to dissect conserved ubiquitination mechanisms due to its invariant cell lineages, well-defined apoptotic cascade, and a conserved repertoire of the majority of annotated E3 ligases (Conradt 2005; Kipreos, 2005). Although
eel-1
is genetically implicated in germline checkpoint signaling, neuronal development, and embryogenesis, the spatial distribution and endogenous subcellular localization of the native protein remain unresolved.
To determine the endogenous expression pattern of
EEL-1
, we generated an endogenous GFP knock-in,
eel-1
::gfp
, at the endogenous
eel-1
locus using CRISPR/Cas9 genome editing. Confocal microscopy of adult hermaphrodites revealed widespread, punctate, and nuclear-enriched
EEL-1
::GFP signal distributed across distinct reproductive and somatic tissues (Figure A–A''). Within the reproductive system, robust
EEL-1
::GFP fluorescence was detected throughout the germline syncytium, pachytene-stage germ cell nuclei, and developing proximal oocytes (spanning the –3 to –1 oocytes), along with distinct localization in the spermatheca (Figure B–B'').
This pronounced germline accumulation is consistent with the established genetic requirement for
eel-1
in driving DNA damage-induced germ cell apoptosis and preserving oocyte quality (Ross, 2011). In somatic tissues, a prominent
EEL-1
::GFP signal was observed in anterior neuronal cell bodies within the head ganglion and in the pharynx (Figure C–C''). The pronounced neuronal localization corroborates reports identifying
EEL-1
as a key regulator of axon termination, neurite pruning, and synaptic remodeling (Opperman, 2017; Xie, 2023). In early multi-cell stage embryos,
EEL-1
::GFP was ubiquitously expressed and distinctly enriched in blastomere nuclei (Figure D–D''). This embryonic accumulation underpins the essential developmental role of
EEL-1
in governing the spatial asymmetry and targeted proteolysis of the maternal transcription factor
SKN-1
, which is indispensable for proper mesendodermal and pharyngeal cell fate specification during early embryonic cleavage (Page, 2007).
In summary, our endogenous CRISPR-tagged reporter provides an
in vivo
spatiotemporal map of
EEL-1
in
C. elegans
. The enriched expression of
EEL-1
::GFP in the germline, nervous system, and developing embryonic blastomeres visually confirms prior functional genetic models and provides a direct anatomical foundation for identifying novel, tissue-specific HUWE1/
EEL-1
degradation substrates.
Methods
Microscopy
. All fluorescence imaging was performed using a spinning-disk confocal system with a Nikon 10x objective, a 60× 1.2 NA water-immersion objective, a Hamamatsu C15440 ORCA-Fusion BT Digital camera, and a Yokogawa CSU-X1 confocal scanner unit. Imaging acquisition was controlled by Nikon's NIS-Elements software (Version 6.10). Image processing and channel merging were conducted using the ImageJ/FIJI Bio-Formats plugin (Fiji/ImageJ: ImageJ version 1.54f; Bio-Formats plugin: version 7.0.0) (National Institutes of Health) (Linkert et al., 2010; Schindelin et al., 2012).
Mounting
C. elegans
for imaging.
Animals were mounted on 7% agarose pads in M9 buffer containing 7.5 mM levamisole and covered with a coverslip. The synchronized day-one adult animals were used for imaging in panels A–D.
Generation of CRISPR knock-in strains.
CRISPR/Cas9 editing was performed using the Bristol
N2
strain as the wild type. Repair templates and single-stranded DNA oligos were synthesized by Integrated DNA Technologies (IDT). Synthetic crRNAs and tracrRNA were purchased from Horizon Discovery. Approximately 25 young adult hermaphrodites were injected with the CRISPR/Cas9 injection mix. The C-terminal tag was amplified from the plasmid pDD282, which contains
C. elegans
codon-optimized GFP. We co-injected the
dpy-10
(
cn64
)
roller marker with the
EEL-1
::GFP injection reagent (Arribere et al., 2014). F1 roller progeny of injected animals were initially selected based on visible GFP expression and subsequently screened by single-worm PCR across the insertion boundaries using the primers:
Forward 5' tccctgttcgttttcagCTTC 3'
Reverse 5' taacggggaccacgtatcag 3'.
The amplification sequence is shown below, with green letters indicating the GFP sequence.
tccctgttcgttttcagCTTCAATCAACTGGATTTACCGCAATACGAGTCATACGAAAAGCTACGTCAATCACTTCTCTTGGCAATTCGTGAATGCACAGAAGGCTTTGGATTCGCCggagcatcgggagcctcaggagcatcgatgagtaaaggagaagaattgttcactggagttgtcccaatcctcgtcgagctcgacggagacgtcaacggacacaagttctccgtctccggagagggagagggagacgccacctacggaaagctcaccctcaagttcatctgcaccaccggaaagctcccagtcccatggccaaccctcgtcaccaccttctgctacggagtccaatgcttctcccgttacccagaccacatgaagcgtcacgacttcttcaagtccgccatgccagagggatacgtccaagagcgtaccatcttcttcaaggtaagtttaaacatatatatactaactactgattatttaaattttcaggacgacggaaactacaagacccgtgccgaggtcaagttcgagggagacaccctcgtcaaccgtatcgagctcaaggtaagtttaaacagttcggtactaactaaccatacatatttaaattttcagggaatcgacttcaaggaggacggaaacatcctcggacacaagctcgagtacaactacaactcccacaacgtctacatcatggccgacaagcaaaagaacggaatcaaggtcaacttcaaggtaagtttaaacatgattttactaactaactaatctgatttaaattttcagatccgtcacaacatcgaggacggatccgtccaactcgccgaccactaccaacaaaacaccccaatcggagacggaccagtcctcctcccagacaaccactacctctccacccaatccgccctctccaaggacccaaacgagaagcgtgaccacatggtcctcctcgagttcgtcaccgccgccggaatcacccacggaatggacgagctctacaagTAAatctccctctgtatacaccaattctggaataattattcccgatattttttattttttttttttcgtttcttaaagcttctcttattttccctgatacgtggtccccgtta
Candidate insertions were validated by Sanger sequencing of both the 5′ and 3′ genomic junctions. All
EEL-1
::GFP lines used for imaging were established as homozygous knock-in stocks before imaging.
EEL-1
::GFP CRISPR information:
Guide RNA: 5' GTGTATACAGAGGGAGATTT 3'. Repair template primer F1: 5' CAATTCGTGAATGCACAGAAGGCTTTGGATTCGCC ggagcatcgggagcctcagg 3'. Repair template primer R1: 5' taattattccagaattggtgtatacagagggagatTTA CTTGTAGAGCTCGTCCATTC 3'. Genotype Primer F1: 5' tccctgttcgttttcagCTTC 3'. Genotype Primer R1: 5' taacggggaccacgtatcag 3'. wt amplicon size: 227 bp
EEL-1
::GFP amplicon size: 1121 bp.
dpy-10
(
cn64
)
CRISPR information: Guide RNA: 5' GCTACCATAGGCACCACGAG”. Repair template: 5' CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCATGCGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT 3'